Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2968Btlr/Mmmh
Stock Number:
040524-MU
Citation ID:
RRID:MMRRC_040524-MU
Other Names:
R2968 (G1), C57BL/6J-MtgxR2968Btlr
Major Collection:

Strain Information

Dusp1
Name: dual specificity phosphatase 1
Synonyms: mkp-1, erp, 3CH134, Ptpn16, MKP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19252
HGNC: HGNC:3064
Homologene: 3254
Pcbp1
Name: poly(rC) binding protein 1
Synonyms: [a]CP-1, WBP17, hnRNP E1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23983
HGNC: HGNC:8647
Homologene: 68506
Arhgap12
Name: Rho GTPase activating protein 12
Synonyms: 2810011M08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75415
Homologene: 23089
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Ddx54
Name: DEAD box helicase 54
Synonyms: APR-5, DP97, 2410015A15Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71990
Homologene: 5590
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Vipas39
Name: VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms: SPE-39, Vipar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104799
VEGA: 12
Homologene: 41464
Efs
Name: embryonal Fyn-associated substrate
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13644
VEGA: 14
Homologene: 4284
Tes
Name: testin LIM domain protein
Synonyms: Tes2, Tes1, testin2, testin, D6Ertd352e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21753
Homologene: 41051
Zfp507
Name: zinc finger protein 507
Synonyms: A230056M16Rik, 1810022O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668501
Homologene: 8942
Wdr75
Name: WD repeat domain 75
Synonyms: 1300003A18Rik, 2410118I19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73674
Homologene: 32771
Dsg3
Name: desmoglein 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13512
VEGA: 18
HGNC: HGNC:3050
Homologene: 55513
Mipol1
Name: mirror-image polydactyly 1
Synonyms: 1700081O04Rik, 6030439O22Rik, D12Ertd19e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73490
Homologene: 16340
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Serpina3n
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3N
Synonyms: Spi2-2, Spi2.2, Spi2/eb.4, antitrypsin, alpha-1 antiproteinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20716
HGNC: HGNC:16
Homologene: 111129
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Fam83g
Name: family with sequence similarity 83, member G
Synonyms: 2310040C09Rik, wly
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69640
Homologene: 85169
4930435H24Rik
Name: RIKEN cDNA 4930435H24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Mrgprb5
Name: MAS-related GPR, member B5
Synonyms: MrgB5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404239
Homologene: 115575
Or51b6
Name: olfactory receptor family 51 subfamily B member 6
Synonyms: 5'[b]3, MOR1-2, GA_x6K02T2PBJ9-6634906-6633983, Olfr65
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18365
Homologene: 66459
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Spink11
Name: serine peptidase inhibitor, Kazal type 11
Synonyms: 9230112K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433181
Homologene: 128818
Cnga3
Name: cyclic nucleotide gated channel alpha 3
Synonyms: CNG3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12790
HGNC: HGNC:2150
Homologene: 994
3110039M20Rik
Name: RIKEN cDNA 3110039M20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67293
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 37,261,078 bp
  • A to G, chromosome 1 at 45,817,341 bp
  • A to G, chromosome 4 at 86,781,644 bp
  • T to A, chromosome 5 at 8,861,485 bp
  • A to G, chromosome 5 at 45,169,410 bp
  • T to A, chromosome 5 at 120,618,629 bp
  • A to G, chromosome 6 at 17,096,234 bp
  • C to T, chromosome 6 at 86,525,489 bp
  • A to G, chromosome 6 at 89,342,608 bp
  • A to T, chromosome 7 at 35,776,342 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to A, chromosome 7 at 48,168,569 bp
  • T to A, chromosome 7 at 56,157,012 bp
  • T to C, chromosome 7 at 103,907,312 bp
  • G to T, chromosome 9 at 108,832,191 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to A, chromosome 11 at 61,703,478 bp
  • A to G, chromosome 11 at 120,817,119 bp
  • T to G, chromosome 12 at 49,390,476 bp
  • T to A, chromosome 12 at 57,364,118 bp
  • T to C, chromosome 12 at 87,242,571 bp
  • C to T, chromosome 12 at 104,409,074 bp
  • T to C, chromosome 14 at 54,919,681 bp
  • A to T, chromosome 17 at 26,507,705 bp
  • A to T, chromosome 18 at 6,111,732 bp
  • A to T, chromosome 18 at 20,525,225 bp
  • A to T, chromosome 18 at 44,195,710 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2968 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040524-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.