Strain Name:
C57BL/6J-MtgxR3124Btlr/Mmmh
Stock Number:
040597-MU
Citation ID:
RRID:MMRRC_040597-MU
Other Names:
R3124 (G1), C57BL/6J-MtgxR3124Btlr
Major Collection:

Strain Information

Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Cd80
Name: CD80 antigen
Synonyms: Cd28l, B7.1, Ly-53, B7-1, Ly53
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12519
VEGA: 16
HGNC: HGNC:1700
Homologene: 3804
Cadm1
Name: cell adhesion molecule 1
Synonyms: RA175C, 3100001I08Rik, SynCam, Igsf4, Igsf4a, SgIGSF, 2900073G06Rik, Tslc1, RA175N, RA175B, RA175A, Necl2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Hsd17b12
Name: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: keratonectin, 2610510O05Rik, keratoadhesin, KIK-I
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56348
Homologene: 95094
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Fam91a1
Name: family with sequence similarity 91, member A1
Synonyms: D15Ertd621e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210998
VEGA: 15
Homologene: 13388
Trmt13
Name: tRNA methyltransferase 13
Synonyms: 4631408H19Rik, Ccdc76, A930028L21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229780
Homologene: 6875
Skil
Name: SKI-like
Synonyms: SnoN, sno-dE3, Skir, SnoN2, 9130011J04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20482
Homologene: 3948
Trappc9
Name: trafficking protein particle complex 9
Synonyms: Nibp, 1810044A24Rik, TRS130, 4632408O18Rik, 2900005P22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Dyrk1a
Name: dual-specificity tyrosine phosphorylation regulated kinase 1a
Synonyms: 2310043O08Rik, D16Ertd493e, Mnbh, D16Ertd272e, Dyrk
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13548
HGNC: HGNC:3091
Homologene: 55576
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Sh2bp1, Tsbp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Drd3
Name: dopamine receptor D3
Synonyms: D3 receptor, D3R
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13490
VEGA: 16
HGNC: HGNC:3024
Homologene: 623
Nop2
Name: NOP2 nucleolar protein
Synonyms: 120kDa, Nol1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110109
HGNC: HGNC:7867
Homologene: 135865
Nipsnap2
Name: nipsnap homolog 2
Synonyms: Gbas, Nipsnap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14467
HGNC: HGNC:4179
Homologene: 1137
Zfp574
Name: zinc finger protein 574
Synonyms: A630056B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232976
Homologene: 11238
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Pthlh
Name: parathyroid hormone-like peptide
Synonyms: PTH-like, parathyroid hormone-like hormone, parathyroid hormone-related protein, parathyroid hormone-related peptide, PTH-related peptide, Pthrp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19227
HGNC: HGNC:9607
Homologene: 2113
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, 5830418G11Rik, RALGEF2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Dppa2
Name: developmental pluripotency associated 2
Synonyms: ECAT15-2, 2410088E07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73703
VEGA: 16
Homologene: 79572
Fem1b
Name: fem 1 homolog b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14155
VEGA: 9
HGNC: HGNC:3649
Homologene: 7714
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Fam227b
Name: family with sequence similarity 227, member B
Synonyms: 4930525F21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75823
Homologene: 27384
Gm9839
Name: predicted gene 9839
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 408192
Homologene: 130042
Caskin2
Name: CASK-interacting protein 2
Synonyms: 1600028L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140721
Homologene: 32485
Vmn1r87
Name: vomeronasal 1 receptor 87
Synonyms: V1rk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171261
Homologene: 134023
Tas2r140
Name: taste receptor, type 2, member 140
Synonyms: TRB5, Tas2r40, mTRB3, T2R40, mt2r64, TRB3, Tas2r13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387616
Homologene: 87013
Tas2r129
Name: taste receptor, type 2, member 129
Synonyms: T2R29, mt2r60, Tas2r29, mGR29
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387354
Homologene: 130074
Dcaf8l
Name: DDB1 and CUL4 associated factor 8 like
Synonyms: Pet2, PC326, Pex3, PC231
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 18630
Homologene: 137214
Bag4
Name: BCL2-associated athanogene 4
Synonyms: 2410112I15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67384
HGNC: HGNC:940
Homologene: 31270
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: Fam179b, A430041B07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
Vav3
Name: vav 3 oncogene
Synonyms: Idd18.1, A530094I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Mcpt8
Name: mast cell protease 8
Synonyms: MMCP-8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17231
VEGA: 14
Dach2
Name: dachshund family transcription factor 2
Synonyms: 9430028N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 93837
Homologene: 33472
Trim12a
Name: tripartite motif-containing 12A
Synonyms: 2310043C01Rik, Trim12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76681
Abhd16b
Name: abhydrolase domain containing 16B
Synonyms: BC050777
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241850
Homologene: 15422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 32,519,777 bp
  • T to C, chromosome 2 at 33,158,956 bp
  • C to T, chromosome 2 at 94,033,958 bp
  • T to C, chromosome 2 at 126,124,086 bp
  • G to A, chromosome 2 at 181,494,526 bp
  • A to G, chromosome 3 at 31,097,338 bp
  • G to A, chromosome 3 at 109,628,168 bp
  • T to C, chromosome 3 at 116,590,244 bp
  • A to G, chromosome 5 at 114,328,799 bp
  • G to A, chromosome 5 at 129,748,034 bp
  • G to A, chromosome 6 at 125,132,201 bp
  • A to G, chromosome 6 at 132,951,448 bp
  • T to A, chromosome 6 at 133,055,241 bp
  • A to T, chromosome 6 at 147,263,291 bp
  • A to G, chromosome 7 at 13,131,566 bp
  • G to T, chromosome 7 at 25,081,601 bp
  • G to T, chromosome 7 at 104,300,856 bp
  • C to T, chromosome 7 at 111,053,446 bp
  • C to T, chromosome 8 at 25,769,488 bp
  • A to G, chromosome 8 at 56,125,209 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • A to G, chromosome 9 at 47,799,477 bp
  • T to C, chromosome 9 at 62,796,554 bp
  • A to T, chromosome 11 at 69,735,710 bp
  • T to C, chromosome 11 at 115,804,797 bp
  • G to T, chromosome 12 at 64,966,344 bp
  • C to T, chromosome 12 at 70,248,393 bp
  • GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC, chromosome 13 at 98,867,129 bp
  • A to T, chromosome 14 at 56,083,941 bp
  • A to G, chromosome 15 at 58,421,889 bp
  • G to A, chromosome 15 at 73,025,967 bp
  • T to A, chromosome 16 at 38,473,893 bp
  • T to C, chromosome 16 at 43,822,792 bp
  • T to C, chromosome 16 at 48,314,197 bp
  • G to A, chromosome 16 at 94,668,801 bp
  • A to G, chromosome 18 at 77,431,078 bp
  • A to T, chromosome X at 89,404,721 bp
  • T to C, chromosome X at 113,819,967 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3124 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040597-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.