Strain Name:
C57BL/6J-MtgxR3157Btlr/Mmmh
Stock Number:
040608-MU
Citation ID:
RRID:MMRRC_040608-MU
Other Names:
R3157 (G1), C57BL/6J-MtgxR3157Btlr
Major Collection:

Gene Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Ociad1
Name: OCIA domain containing 1
Synonyms: expressed during mesenchymal induction 2, Emi2, B230209J16Rik, 6030432N09Rik, TPA018, Asrij, Imi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68095
Homologene: 9866
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 74374
Homologene: 71019
Rasal2
Name: RAS protein activator like 2
Synonyms: A330066M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226525
HGNC: HGNC:9874
Homologene: 35217
Ttll4
Name: tubulin tyrosine ligase-like family, member 4
Synonyms: 4632407P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67534
Homologene: 8764
Bmp1
Name: bone morphogenetic protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12153
VEGA: 14
HGNC: HGNC:1067
Homologene: 55955
Smu1
Name: smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms: 2600001O03Rik, SMU-1, 2610203K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74255
Homologene: 10079
Klrb1c
Name: killer cell lectin-like receptor subfamily B member 1C
Synonyms: Nkrp1-c, NK-RP1, Nk1.1, CD161, NK-1.1, Ly-59, Nk-1, Ly55c, Nk-1.2, NKR-P1, Nk1, Ly59, NKR-P1C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17059
HGNC: HGNC:6373
Homologene: 84369
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: MFT.M05.13, Hcapg, 5730507H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54392
Homologene: 44071
Cep95
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320162
Homologene: 16297
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 623474
Homologene: 8240
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230145
Homologene: 11637
Rec8
Name: REC8 meiotic recombination protein
Synonyms: mrec, Rec8L1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 56739
Homologene: 3768
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Pced1a
Name: PC-esterase domain containing 1A
Synonyms: A930025D01Rik, Fam113a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319513
Homologene: 11241
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Plcd4
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18802
HGNC: HGNC:9062
Homologene: 88782
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Dmpk
Name: dystrophia myotonica-protein kinase
Synonyms: DM, Dm15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13400
HGNC: HGNC:2933
Homologene: 3247
Pigg
Name: phosphatidylinositol glycan anchor biosynthesis, class G
Synonyms: Gpi7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 433931
Homologene: 39421
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Kcns1
Name: K+ voltage-gated channel, subfamily S, 1
Synonyms: Kv9.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16538
HGNC: HGNC:6300
Homologene: 20517
Prss52
Name: protease, serine 52
Synonyms: 1700049K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 73382
Homologene: 105740
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Synpr
Name: synaptoporin
Synonyms: 1500003F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72003
Homologene: 11407
Gxylt1
Name: glucoside xylosyltransferase 1
Synonyms: LOC223827, LOC382997, Glt8d3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223827
Homologene: 28259
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 110893
Homologene: 62645
Aoc2
Name: amine oxidase, copper containing 2 (retina-specific)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237940
HGNC: HGNC:549
Homologene: 56457
Cd300e
Name: CD300E molecule
Synonyms: Clm2, Trem5, Cd300le
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217306
Homologene: 18145
Olfr1453
Name: olfactory receptor 1453
Synonyms: GA_x6K02T2RE5P-3357666-3356743, MOR202-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258695
Homologene: 120159
Slc9b1
Name: solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms: 4933424B12Rik, 1700094G20Rik, 4933425K02Rik, Nhedc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74446
Homologene: 49914
Pcgf6
Name: polycomb group ring finger 6
Synonyms: Mel18 and Bmi1-like RING finger protein, MBLR, 4933407A11Rik, Rnf134
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71041
VEGA: 19
Homologene: 12378
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Ap1g2
Name: adaptor protein complex AP-1, gamma 2 subunit
Synonyms: gamma 2-adaptin, Adtg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11766
HGNC: HGNC:556
Homologene: 49141
Mmp11
Name: matrix metallopeptidase 11
Synonyms: stromelysin 3, ST3, Stmy3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17385
HGNC: HGNC:7157
Homologene: 38116
Med14
Name: mediator complex subunit 14
Synonyms: ORF1, LOC270579, 9930001L01Rik, Trap170, Crsp2, ENSMUSG00000073278
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 26896
HGNC: HGNC:2370
Homologene: 22082
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: RED2, Adar3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329679
Homologene: 46417
Slc16a8
Name: solute carrier family 16 (monocarboxylic acid transporters), member 8
Synonyms: proton-coupled monocarboxylate transporter 3, Mct3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 57274
Homologene: 75006
Mgat4d
Name: MGAT4 family, member C
Synonyms: 4933434I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67555
Homologene: 128538
Ddx43
Name: DEAD box helicase 43
Synonyms: ENSMUSG00000070291, OTTMUSG00000019690, DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100048658
Homologene: 56814
Sectm1a
Name: secreted and transmembrane 1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 209588
Homologene: 134112
1700060C20Rik
Name: RIKEN cDNA 1700060C20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73399
Arhgap27
Name: Rho GTPase activating protein 27
Synonyms: 2310069I04Rik, 5730442P18Rik, Sh3d20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 544817
Homologene: 45715
Ccr4
Name: chemokine (C-C motif) receptor 4
Synonyms: CC CKR-4, Cmkbr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12773
VEGA: 9
HGNC: HGNC:1605
Homologene: 21135
Npas2
Name: neuronal PAS domain protein 2
Synonyms: MOP4, bHLHe9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18143
HGNC: HGNC:7895
Homologene: 1887
Nps
Name: neuropeptide S
Synonyms: ENSMUSG00000073804
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043254
Homologene: 106066
Tpt1
Name: tumor protein, translationally-controlled 1
Synonyms: Trt, fortilin, TCTP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22070
Homologene: 55730
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 39,347,609 bp
  • G to A, chromosome 1 at 74,551,154 bp
  • T to C, chromosome 1 at 74,697,611 bp
  • A to G, chromosome 1 at 157,158,655 bp
  • A to G, chromosome 2 at 31,400,255 bp
  • A to G, chromosome 2 at 130,419,767 bp
  • A to C, chromosome 2 at 158,195,472 bp
  • G to A, chromosome 2 at 164,164,945 bp
  • T to C, chromosome 3 at 79,567,594 bp
  • G to A, chromosome 3 at 135,371,845 bp
  • C to T, chromosome 4 at 11,599,666 bp
  • T to A, chromosome 4 at 40,754,529 bp
  • A to G, chromosome 4 at 47,104,264 bp
  • T to A, chromosome 5 at 45,676,058 bp
  • A to T, chromosome 5 at 73,310,345 bp
  • C to T, chromosome 5 at 108,314,148 bp
  • T to A, chromosome 6 at 118,751,524 bp
  • G to T, chromosome 6 at 128,784,739 bp
  • A to G, chromosome 7 at 19,093,019 bp
  • A to G, chromosome 7 at 135,272,260 bp
  • T to C, chromosome 8 at 83,354,821 bp
  • A to G, chromosome 8 at 110,267,373 bp
  • T to C, chromosome 9 at 78,412,183 bp
  • G to T, chromosome 9 at 114,492,282 bp
  • C to T, chromosome 10 at 75,927,114 bp
  • T to C, chromosome 10 at 92,999,056 bp
  • A to T, chromosome 10 at 127,245,441 bp
  • A to T, chromosome 11 at 101,329,276 bp
  • T to A, chromosome 11 at 103,333,837 bp
  • A to G, chromosome 11 at 106,809,187 bp
  • A to C, chromosome 11 at 115,062,023 bp
  • A to G, chromosome 11 at 121,068,777 bp
  • T to C, chromosome 12 at 78,492,029 bp
  • C to A, chromosome 12 at 81,314,992 bp
  • G to T, chromosome 12 at 104,700,534 bp
  • A to T, chromosome 13 at 8,697,633 bp
  • C to T, chromosome 14 at 13,493,614 bp
  • A to T, chromosome 14 at 55,099,274 bp
  • A to G, chromosome 14 at 55,625,306 bp
  • G to T, chromosome 14 at 64,113,543 bp
  • G to T, chromosome 14 at 70,492,107 bp
  • G to A, chromosome 14 at 75,846,400 bp
  • T to C, chromosome 15 at 79,252,175 bp
  • A to G, chromosome 15 at 93,245,032 bp
  • A to G, chromosome 16 at 10,731,832 bp
  • T to C, chromosome 16 at 96,678,510 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to C, chromosome 19 at 13,028,047 bp
  • T to C, chromosome 19 at 25,149,831 bp
  • T to C, chromosome 19 at 47,040,036 bp
  • G to A, chromosome X at 12,684,091 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3157 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.