Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3157Btlr/Mmmh
Stock Number:
040608-MU
Citation ID:
RRID:MMRRC_040608-MU
Other Names:
R3157 (G1), C57BL/6J-MtgxR3157Btlr
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Ociad1
Name: OCIA domain containing 1
Synonyms: expressed during mesenchymal induction 2, Emi2, B230209J16Rik, 6030432N09Rik, TPA018, Asrij, Imi2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68095
Homologene: 9866
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74374
Homologene: 71019
Rasal2
Name: RAS protein activator like 2
Synonyms: A330066M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226525
HGNC: HGNC:9874
Homologene: 35217
Ttll4
Name: tubulin tyrosine ligase-like family, member 4
Synonyms: 4632407P03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67534
Homologene: 8764
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 39,347,609 bp
  • G to A, chromosome 1 at 74,551,154 bp
  • T to C, chromosome 1 at 74,697,611 bp
  • A to G, chromosome 1 at 157,158,655 bp
  • A to G, chromosome 2 at 31,400,255 bp
  • A to G, chromosome 2 at 130,419,767 bp
  • A to C, chromosome 2 at 158,195,472 bp
  • G to A, chromosome 2 at 164,164,945 bp
  • T to C, chromosome 3 at 79,567,594 bp
  • G to A, chromosome 3 at 135,371,845 bp
  • C to T, chromosome 4 at 11,599,666 bp
  • T to A, chromosome 4 at 40,754,529 bp
  • A to G, chromosome 4 at 47,104,264 bp
  • T to A, chromosome 5 at 45,676,058 bp
  • A to T, chromosome 5 at 73,310,345 bp
  • C to T, chromosome 5 at 108,314,148 bp
  • T to A, chromosome 6 at 118,751,524 bp
  • G to T, chromosome 6 at 128,784,739 bp
  • A to G, chromosome 7 at 19,093,019 bp
  • A to G, chromosome 7 at 135,272,260 bp
  • T to C, chromosome 8 at 83,354,821 bp
  • A to G, chromosome 8 at 110,267,373 bp
  • T to C, chromosome 9 at 78,412,183 bp
  • G to T, chromosome 9 at 114,492,282 bp
  • C to T, chromosome 10 at 75,927,114 bp
  • T to C, chromosome 10 at 92,999,056 bp
  • A to T, chromosome 10 at 127,245,441 bp
  • A to T, chromosome 11 at 101,329,276 bp
  • T to A, chromosome 11 at 103,333,837 bp
  • A to G, chromosome 11 at 106,809,187 bp
  • A to C, chromosome 11 at 115,062,023 bp
  • A to G, chromosome 11 at 121,068,777 bp
  • T to C, chromosome 12 at 78,492,029 bp
  • C to A, chromosome 12 at 81,314,992 bp
  • G to T, chromosome 12 at 104,700,534 bp
  • A to T, chromosome 13 at 8,697,633 bp
  • C to T, chromosome 14 at 13,493,614 bp
  • A to T, chromosome 14 at 55,099,274 bp
  • A to G, chromosome 14 at 55,625,306 bp
  • G to T, chromosome 14 at 64,113,543 bp
  • G to T, chromosome 14 at 70,492,107 bp
  • G to A, chromosome 14 at 75,846,400 bp
  • T to C, chromosome 15 at 79,252,175 bp
  • A to G, chromosome 15 at 93,245,032 bp
  • A to G, chromosome 16 at 10,731,832 bp
  • T to C, chromosome 16 at 96,678,510 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to C, chromosome 19 at 13,028,047 bp
  • T to C, chromosome 19 at 25,149,831 bp
  • T to C, chromosome 19 at 47,040,036 bp
  • G to A, chromosome X at 12,684,091 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3157 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.