Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4155Btlr/Mmmh
Stock Number:
040999-MU
Citation ID:
RRID:MMRRC_040999-MU
Other Names:
R4155 (G1), C57BL/6J-MtgxR4155Btlr
Major Collection:

Strain Information

Casq2
Name: calsequestrin 2
Synonyms: cardiac calsequestrin, ESTM52, cCSQ, Csq2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12373
HGNC: HGNC:1513
Homologene: 20330
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Ash2l
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23808
HGNC: HGNC:744
Homologene: 3436
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Ndufs4
Name: NADH:ubiquinone oxidoreductase core subunit S4
Synonyms: C1-18k, 6720411N02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17993
VEGA: 13
HGNC: HGNC:7711
Homologene: 1866
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Git1
Name: GIT ArfGAP 1
Synonyms: p95Cat, Cat-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216963
HGNC: HGNC:4272
Homologene: 32204
Rasa2
Name: RAS p21 protein activator 2
Synonyms: GAP1m, 5430433H21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114713
HGNC: HGNC:9872
Homologene: 4745
Pou4f1
Name: POU domain, class 4, transcription factor 1
Synonyms: Brn-3, Brn3a, Brn3, Brn-3.0, E130119J07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18996
HGNC: HGNC:9218
Homologene: 21255
Bsx
Name: brain specific homeobox
Synonyms: Bsx1b, Bsx1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244813
Homologene: 65347
Zfp410
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52708
VEGA: 12
Homologene: 10918
Dhx33
Name: DEAH-box helicase 33
Synonyms: Ddx33, 9430096J02Rik, 3110057P17Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 33
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216877
Homologene: 56235
Samd4
Name: sterile alpha motif domain containing 4
Synonyms: 4933436G17Rik, 1700111L17Rik, 1700024G08Rik, Smaug, sunk
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74480
Homologene: 19167
P2rx5
Name: purinergic receptor P2X, ligand-gated ion channel, 5
Synonyms: P2X5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94045
HGNC: HGNC:8536
Homologene: 1924
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Or14a259
Name: olfactory receptor family 14 subfamily A member 259
Synonyms: GA_x6K02T2NHDJ-9744055-9745014, MOR219-2, Olfr305
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258609
Homologene: 128128
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: COUP-TF interacting protein 2, CTIP2, B630002E05Rik, Rit1, 9130430L19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58208
Homologene: 10974
Tns1
Name: tensin 1
Synonyms: 1200014E20Rik, 1110018I21Rik, E030018G17Rik, Tns, E030037J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Idh3b
Name: isocitrate dehydrogenase 3 (NAD+) beta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170718
HGNC: HGNC:5385
Homologene: 5035
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: PKB gamma, D930002M15Rik, Nmf350
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Or52s19
Name: olfactory receptor family 52 subfamily S member 19
Synonyms: GA_x6K02T2PBJ9-6068534-6067590, MOR24-3, Olfr601
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258311
Homologene: 64851
Ncan
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13004
HGNC: HGNC:2465
Homologene: 3229
Or8d1b
Name: olfactory receptor family 8 subfamily D member 1B
Synonyms: GA_x6K02T2PVTD-32671531-32672457, MOR171-22, Olfr933
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258433
VEGA: 9
HGNC: HGNC:8481
Homologene: 79676
2410004B18Rik
Name: RIKEN cDNA 2410004B18 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66421
Homologene: 11968
Ica1l
Name: islet cell autoantigen 1-like
Synonyms: 1700030B17Rik, Als2cr15, b2b3465Clo
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70375
Homologene: 16323
D6Ertd527e
Name: DNA segment, Chr 6, ERATO Doi 527, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52372
Ecd
Name: ecdysoneless cell cycle regulator
Synonyms: 5730461K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70601
VEGA: 14
Homologene: 5256
Tnfsf11
Name: tumor necrosis factor (ligand) superfamily, member 11
Synonyms: RANKL, OPGL, ODF, Ly109l, Trance, osteoclast differentiation factor, OPGL
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21943
VEGA: 14
Homologene: 2744
Tmem232
Name: transmembrane protein 232
Synonyms: LOC381107, E130009J12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381107
VEGA: 17
Homologene: 54378
Tmcc1
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330401
Homologene: 8995
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Ccpg1
Name: cell cycle progression 1
Synonyms: 1700030B06Rik, 1810073J13Rik, D9Ertd392e, 9430028F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72278
Homologene: 3487
Hoxd9
Name: homeobox D9
Synonyms: Hox-5.2, Hox-4.4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15438
HGNC: HGNC:5140
Homologene: 8409
Nalf1
Name: NALCN channel auxiliary factor 1
Synonyms: Fam155a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270028
Homologene: 83472
Kcnj15
Name: potassium inwardly-rectifying channel, subfamily J, member 15
Synonyms: IRKK, Kir4.2, 4930414N08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16516
HGNC: HGNC:6261
Homologene: 1690
Mtfr1l
Name: mitochondrial fission regulator 1-like
Synonyms: 2410166I05Rik, Fam54b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76824
Homologene: 10472
Or4c127
Name: olfactory receptor family 4 subfamily C member 127
Synonyms: GA_x6K02T2Q125-51434523-51435437, MOR234-1, Olfr1262
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258976
Homologene: 74064
Mettl4
Name: methyltransferase 4, N6-adenosine
Synonyms: HsT661, 2410198H06Rik, A730091E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76781
VEGA: 17
Homologene: 35305
Srgn
Name: serglycin
Synonyms: Sgc, Prg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19073
HGNC: HGNC:9361
Homologene: 137238
Rpl31-ps17
Name: ribosomal protein L31, pseudogene 17
Synonyms: Gm16382
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 673582
Cst8
Name: cystatin 8 (cystatin-related epididymal spermatogenic)
Synonyms: Cst-rs1, Cres
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13012
HGNC: HGNC:2480
Homologene: 4011
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 60,013,893 bp
  • T to A, chromosome 1 at 73,914,631 bp
  • T to G, chromosome 1 at 172,101,425 bp
  • T to A, chromosome 1 at 175,769,606 bp
  • A to G, chromosome 1 at 177,096,977 bp
  • A to G, chromosome 2 at 74,699,323 bp
  • A to G, chromosome 2 at 90,002,660 bp
  • C to T, chromosome 2 at 119,774,179 bp
  • A to T, chromosome 2 at 130,283,852 bp
  • C to A, chromosome 2 at 148,800,076 bp
  • A to T, chromosome 3 at 102,133,102 bp
  • T to A, chromosome 3 at 145,938,263 bp
  • A to G, chromosome 4 at 134,530,674 bp
  • A to G, chromosome 5 at 34,009,649 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • C to T, chromosome 6 at 116,133,804 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • T to A, chromosome 7 at 86,364,062 bp
  • T to C, chromosome 7 at 103,359,156 bp
  • T to A, chromosome 8 at 9,233,023 bp
  • A to G, chromosome 8 at 25,817,454 bp
  • C to A, chromosome 8 at 70,110,077 bp
  • A to T, chromosome 8 at 127,357,289 bp
  • A to T, chromosome 9 at 38,976,155 bp
  • A to G, chromosome 9 at 40,876,336 bp
  • A to G, chromosome 9 at 60,871,753 bp
  • C to A, chromosome 9 at 73,012,167 bp
  • T to A, chromosome 9 at 95,888,124 bp
  • G to T, chromosome 9 at 96,611,465 bp
  • A to G, chromosome 10 at 42,011,867 bp
  • A to G, chromosome 10 at 62,497,834 bp
  • T to A, chromosome 11 at 23,417,676 bp
  • A to T, chromosome 11 at 71,001,507 bp
  • A to G, chromosome 11 at 73,171,829 bp
  • T to C, chromosome 11 at 77,504,936 bp
  • C to T, chromosome 12 at 54,701,612 bp
  • G to A, chromosome 12 at 84,327,432 bp
  • T to C, chromosome 12 at 85,057,403 bp
  • A to T, chromosome 12 at 107,917,425 bp
  • A to T, chromosome 13 at 114,307,854 bp
  • A to G, chromosome 14 at 20,324,564 bp
  • T to A, chromosome 14 at 47,052,946 bp
  • A to G, chromosome 14 at 78,299,869 bp
  • C to T, chromosome 14 at 104,467,717 bp
  • A to T, chromosome 16 at 95,296,307 bp
  • A to T, chromosome 17 at 65,436,333 bp
  • C to A, chromosome 17 at 74,596,939 bp
  • T to G, chromosome 17 at 74,840,460 bp
  • T to C, chromosome 17 at 94,740,575 bp
  • T to A, chromosome 18 at 38,203,106 bp
  • C to A, chromosome 18 at 58,023,287 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4155 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040999-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.