Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4155Btlr/Mmmh
Stock Number:
040999-MU
Citation ID:
RRID:MMRRC_040999-MU
Other Names:
R4155 (G1), C57BL/6J-MtgxR4155Btlr
Major Collection:

Strain Information

Casq2
Name: calsequestrin 2
Synonyms: cardiac calsequestrin, ESTM52, cCSQ, Csq2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12373
HGNC: HGNC:1513
Homologene: 20330
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Ash2l
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23808
HGNC: HGNC:744
Homologene: 3436
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 60,013,893 bp
  • T to A, chromosome 1 at 73,914,631 bp
  • T to G, chromosome 1 at 172,101,425 bp
  • T to A, chromosome 1 at 175,769,606 bp
  • A to G, chromosome 1 at 177,096,977 bp
  • A to G, chromosome 2 at 74,699,323 bp
  • A to G, chromosome 2 at 90,002,660 bp
  • C to T, chromosome 2 at 119,774,179 bp
  • A to T, chromosome 2 at 130,283,852 bp
  • C to A, chromosome 2 at 148,800,076 bp
  • A to T, chromosome 3 at 102,133,102 bp
  • T to A, chromosome 3 at 145,938,263 bp
  • A to G, chromosome 4 at 134,530,674 bp
  • A to G, chromosome 5 at 34,009,649 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • C to T, chromosome 6 at 116,133,804 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • T to A, chromosome 7 at 86,364,062 bp
  • T to C, chromosome 7 at 103,359,156 bp
  • T to A, chromosome 8 at 9,233,023 bp
  • A to G, chromosome 8 at 25,817,454 bp
  • C to A, chromosome 8 at 70,110,077 bp
  • A to T, chromosome 8 at 127,357,289 bp
  • A to T, chromosome 9 at 38,976,155 bp
  • A to G, chromosome 9 at 40,876,336 bp
  • A to G, chromosome 9 at 60,871,753 bp
  • C to A, chromosome 9 at 73,012,167 bp
  • T to A, chromosome 9 at 95,888,124 bp
  • G to T, chromosome 9 at 96,611,465 bp
  • A to G, chromosome 10 at 42,011,867 bp
  • A to G, chromosome 10 at 62,497,834 bp
  • T to A, chromosome 11 at 23,417,676 bp
  • A to T, chromosome 11 at 71,001,507 bp
  • A to G, chromosome 11 at 73,171,829 bp
  • T to C, chromosome 11 at 77,504,936 bp
  • C to T, chromosome 12 at 54,701,612 bp
  • G to A, chromosome 12 at 84,327,432 bp
  • T to C, chromosome 12 at 85,057,403 bp
  • A to T, chromosome 12 at 107,917,425 bp
  • A to T, chromosome 13 at 114,307,854 bp
  • A to G, chromosome 14 at 20,324,564 bp
  • T to A, chromosome 14 at 47,052,946 bp
  • A to G, chromosome 14 at 78,299,869 bp
  • C to T, chromosome 14 at 104,467,717 bp
  • A to T, chromosome 16 at 95,296,307 bp
  • A to T, chromosome 17 at 65,436,333 bp
  • C to A, chromosome 17 at 74,596,939 bp
  • T to G, chromosome 17 at 74,840,460 bp
  • T to C, chromosome 17 at 94,740,575 bp
  • T to A, chromosome 18 at 38,203,106 bp
  • C to A, chromosome 18 at 58,023,287 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4155 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040999-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.