Strain Name:
C57BL/6J-MtgxR4248Btlr/Mmmh
Stock Number:
041064-MU
Citation ID:
RRID:MMRRC_041064-MU
Other Names:
R4248 (G1), C57BL/6J-MtgxR4248Btlr
Major Collection:

Strain Information

Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Alox12b
Name: arachidonate 12-lipoxygenase, 12R type
Synonyms: e-LOX2, Aloxe2, 12R-LOX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11686
HGNC: HGNC:430
Homologene: 884
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56210
Homologene: 32309
Snx8
Name: sorting nexin 8
Synonyms: B130023O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231834
Homologene: 8338
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Pirb
Name: paired Ig-like receptor B
Synonyms: Gp91, Lilrb3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18733
Homologene: 134028
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73419
Homologene: 41557
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Tnfrsf1b
Name: tumor necrosis factor receptor superfamily, member 1b
Synonyms: CD120b, TNF-R2, p75, p75 TNFR, Tnfr2, TNF-R75, TNF-R-II, TNFR80, TNFBR, TNFRII, TNF-alphaR2, TNFalpha-R2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21938
Homologene: 829
Ust
Name: uronyl-2-sulfotransferase
Synonyms: D930010O20Rik, UA2OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 338362
VEGA: 10
Homologene: 4174
Hecw2
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: D030049F17Rik, Nedl2, A730039N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329152
Homologene: 66192
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194357
Homologene: 77226
Hnf4g
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 30942
HGNC: HGNC:5026
Homologene: 37886
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627576
Homologene: 115024
Gucd1
Name: guanylyl cyclase domain containing 1
Synonyms: 1110038D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68778
Homologene: 57149
Or8g36
Name: olfactory receptor family 8 subfamily G member 36
Synonyms: GA_x6K02T2PVTD-33208209-33207274, MOR171-12, Olfr957
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258740
VEGA: 9
Fbxo25
Name: F-box protein 25
Synonyms: Fbx25, 9130015I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66822
Homologene: 41649
Gapt
Name: Grb2-binding adaptor, transmembrane
Synonyms: 9830130M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238875
VEGA: 13
Homologene: 51887
2700062C07Rik
Name: RIKEN cDNA 2700062C07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 68046
VEGA: 18
Homologene: 12230
Onecut3
Name: one cut domain, family member 3
Synonyms: OC-3, Oc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 246086
Homologene: 82258
Satl1
Name: spermidine/spermine N1-acetyl transferase-like 1
Synonyms: 4930404K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73809
Homologene: 28332
Gm16764
Name: predicted gene, 16764
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 38,107,648 bp
  • C to T, chromosome 1 at 53,832,645 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • C to T, chromosome 2 at 180,180,427 bp
  • A to G, chromosome 3 at 3,652,849 bp
  • G to A, chromosome 4 at 145,215,965 bp
  • A to G, chromosome 5 at 140,356,045 bp
  • A to C, chromosome 6 at 40,878,999 bp
  • C to T, chromosome 6 at 84,194,342 bp
  • A to G, chromosome 7 at 3,719,298 bp
  • TGGTGAGAGGGGGCCGCCTTGGCCCCG to TG, chromosome 7 at 132,599,480 bp
  • T to C, chromosome 8 at 13,939,617 bp
  • A to G, chromosome 9 at 39,511,603 bp
  • T to C, chromosome 9 at 99,101,176 bp
  • T to C, chromosome 10 at 4,439,687 bp
  • A to T, chromosome 10 at 8,518,218 bp
  • A to G, chromosome 10 at 14,131,555 bp
  • A to T, chromosome 10 at 75,509,828 bp
  • A to G, chromosome 10 at 80,514,129 bp
  • G to A, chromosome 11 at 69,163,605 bp
  • C to A, chromosome 13 at 110,353,755 bp
  • T to C, chromosome 14 at 50,862,894 bp
  • T to C, chromosome 15 at 16,850,388 bp
  • A to T, chromosome 17 at 19,589,114 bp
  • A to G, chromosome 18 at 24,472,956 bp
  • A to G, chromosome 18 at 24,990,066 bp
  • A to G, chromosome X at 112,406,336 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4248 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041064-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.