Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4302Btlr/Mmmh
Stock Number:
041089-MU
Citation ID:
RRID:MMRRC_041089-MU
Other Names:
R4302 (G1), C57BL/6J-MtgxR4302Btlr
Major Collection:

Strain Information

Hcfc1
Name: host cell factor C1
Synonyms: VP16 accessory protein, HCF1, HCF-1
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 15161
HGNC: HGNC:4839
Homologene: 3898
Arhgef12
Name: Rho guanine nucleotide exchange factor 12
Synonyms: LARG, 2310014B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69632
VEGA: 9
Homologene: 9088
Stk24
Name: serine/threonine kinase 24
Synonyms: 1810013H02Rik, STE20
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223255
VEGA: 14
Homologene: 20793
Pdss1
Name: prenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms: 2610203G20Rik, 2700031G06Rik, Tprt, mSPS1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56075
Homologene: 5353
Rps11
Name: ribosomal protein S11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27207
Homologene: 88443
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20133
Homologene: 806
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Clic4
Name: chloride intracellular channel 4
Synonyms: mtCLIC, mc3s5, D0Jmb3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29876
Homologene: 8490
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Tfcp2
Name: transcription factor CP2
Synonyms: LBP-1d, LBP-1c, LSF, UBP-1, CP-2, D230015P20Rik, LBP1, CP2, Tcfcp2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21422
VEGA: 15
Homologene: 4134
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Rhpn2
Name: rhophilin, Rho GTPase binding protein 2
Synonyms: 1300002E07Rik, D7Ertd784e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52428
Homologene: 12407
Nup58
Name: nucleoporin 58
Synonyms: 1700017F11Rik, Nupl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71844
VEGA: 14
Homologene: 40924
Nol12
Name: nucleolar protein 12
Synonyms: C78541, Nop25
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 97961
Homologene: 32577
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208169
Homologene: 19505
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Agl
Name: amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms: 9430004C13Rik, 9630046L06Rik, 1110061O17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77559
HGNC: HGNC:321
Homologene: 536
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Or11j4
Name: olfactory receptor family 11 subfamily J member 4
Synonyms: GA_x6K02T2PMLR-6089963-6090901, MOR106-5, Olfr736
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258660
Homologene: 64902
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, 4933428F06Rik, Wdr66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Gm973
Name: predicted gene 973
Synonyms: LOC381260
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381260
Homologene: 124277
Sgsm3
Name: small G protein signaling modulator 3
Synonyms: 1810012I01Rik, CIP85, Rutbc3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105835
Homologene: 9249
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Ncf4
Name: neutrophil cytosolic factor 4
Synonyms: p40phox
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17972
HGNC: HGNC:7662
Homologene: 525
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Bcas1
Name: brain enriched myelin associated protein 1
Synonyms: NABC1, 2210416M21Rik, 9030223A09Rik, breast carcinoma amplified sequence 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76960
HGNC: HGNC:974
Homologene: 2714
Abhd12
Name: abhydrolase domain containing 12
Synonyms: 6330583M11Rik, 1500011G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76192
Homologene: 22910
Trbv21
Name: T cell receptor beta, variable 21
Synonyms: Tcrb-V19, Gm16778
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124686
Loxl4
Name: lysyl oxidase-like 4
Synonyms: 4833426I20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67573
Homologene: 12977
Or7g30
Name: olfactory receptor family 7 subfamily G member 30
Synonyms: GA_x6K02T2PVTD-13176842-13177780, MOR151-1, Olfr849
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258520
HGNC: HGNC:8466
Homologene: 74179
Vmn2r38
Name: vomeronasal 2, receptor 38
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434110
Homologene: 113703
Vmn2r129
Name: vomeronasal 2, receptor 129
Synonyms: V2r8, V2r9, Vmn2r-ps160, Vmn2r-ps159
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22314
Or12d16-ps1
Name: olfactory receptor family 12 subfamily D member 16, pseudogene 1
Synonyms: MOR250-6, GA_x6K02T2PSCP-1855511-1856437, Olfr106, Olfr106-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257925
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 59,551,240 bp
  • A to T, chromosome 1 at 90,807,614 bp
  • T to C, chromosome 2 at 22,915,505 bp
  • G to T, chromosome 2 at 76,876,467 bp
  • T to C, chromosome 2 at 91,993,319 bp
  • G to A, chromosome 2 at 150,839,722 bp
  • A to G, chromosome 2 at 170,418,627 bp
  • T to C, chromosome 3 at 59,318,750 bp
  • T to C, chromosome 3 at 116,746,630 bp
  • A to G, chromosome 4 at 135,226,039 bp
  • G to T, chromosome 4 at 156,334,397 bp
  • T to C, chromosome 5 at 123,293,810 bp
  • A to G, chromosome 6 at 40,763,085 bp
  • T to A, chromosome 6 at 41,202,768 bp
  • A to G, chromosome 7 at 9,097,563 bp
  • A to T, chromosome 7 at 18,856,531 bp
  • A to G, chromosome 7 at 35,390,845 bp
  • T to C, chromosome 7 at 45,122,944 bp
  • T to A, chromosome 7 at 80,351,739 bp
  • T to C, chromosome 7 at 102,447,824 bp
  • T to A, chromosome 7 at 105,693,954 bp
  • A to T, chromosome 9 at 7,077,880 bp
  • A to G, chromosome 9 at 19,440,999 bp
  • G to A, chromosome 9 at 43,018,349 bp
  • T to A, chromosome 11 at 53,702,005 bp
  • A to T, chromosome 12 at 101,893,768 bp
  • T to C, chromosome 14 at 50,393,446 bp
  • A to G, chromosome 14 at 60,247,426 bp
  • A to G, chromosome 14 at 121,292,082 bp
  • T to C, chromosome 15 at 78,260,762 bp
  • T to C, chromosome 15 at 78,940,141 bp
  • T to A, chromosome 15 at 81,010,301 bp
  • G to T, chromosome 15 at 100,514,849 bp
  • T to A, chromosome 16 at 21,495,914 bp
  • A to T, chromosome 16 at 45,544,791 bp
  • A to G, chromosome 16 at 91,658,411 bp
  • T to A, chromosome 17 at 37,395,486 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • T to C, chromosome 18 at 63,124,730 bp
  • T to A, chromosome 19 at 42,607,591 bp
  • A to G, chromosome X at 73,949,366 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4302 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041089-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.