Strain Name:
C57BL/6J-MtgxR4383Btlr/Mmmh
Stock Number:
041123-MU
Citation ID:
RRID:MMRRC_041123-MU
Other Names:
R4383 (G1), C57BL/6J-MtgxR4383Btlr
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, Mll3, HALR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231051
Homologene: 46480
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, GAD(65), 6330404F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Rsf1
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, XAP8, Hbxap, C030033M12Rik, p325
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Clca2
Name: chloride channel accessory 2
Synonyms: Clca5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229933
HGNC: HGNC:2016
Homologene: 4765
Slit2
Name: slit guidance ligand 2
Synonyms: E130320P19Rik, Slil3, E030015M03Rik, Drad-1, b2b1200.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20563
Homologene: 3516
Arih2
Name: ariadne RBR E3 ubiquitin protein ligase 2
Synonyms: TRIAD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23807
HGNC: HGNC:690
Homologene: 48424
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2410011O22Rik, 2210404J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381062
Homologene: 19936
Fbxl5
Name: F-box and leucine-rich repeat protein 5
Synonyms: Fbl4, Fir4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242960
Homologene: 8129
Zap70
Name: zeta-chain (TCR) associated protein kinase
Synonyms: Srk, TZK, ZAP-70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22637
Homologene: 839
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: E130209G04Rik, ENSMUSG00000043296, 9930021A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Rbp-3, Irbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Sec24c
Name: SEC24 homolog C, COPII coat complex component
Synonyms: 2610204K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218811
VEGA: 14
Homologene: 3615
Asic3
Name: acid-sensing ion channel 3
Synonyms: DRASIC, Accn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 171209
HGNC: HGNC:101
Homologene: 20999
Des
Name: desmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Zfp329
Name: zinc finger protein 329
Synonyms: 2810439M05Rik, 4632409L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67230
Homologene: 23459
Baat
Name: bile acid-Coenzyme A: amino acid N-acyltransferase
Synonyms: BAT, taurine N-acyltransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12012
HGNC: HGNC:932
Homologene: 1286
Dtx1
Name: deltex 1, E3 ubiquitin ligase
Synonyms: Fxit1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14357
HGNC: HGNC:3060
Homologene: 74522
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Or6n2
Name: olfactory receptor family 6 subfamily N member 2
Synonyms: Olfr430, GA_x6K02T2P20D-21108443-21107490, MOR105-5P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258713
Homologene: 17362
Inmt
Name: indolethylamine N-methyltransferase
Synonyms: Temt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21743
HGNC: HGNC:6069
Homologene: 81752
Poc1b
Name: POC1 centriolar protein B
Synonyms: Wdr51b, 4933430F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382406
Homologene: 41728
Trim3
Name: tripartite motif-containing 3
Synonyms: HAC1, Rnf22, BERP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55992
Homologene: 21290
Zfp606
Name: zinc finger protein 606
Synonyms: 2410022M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67370
Homologene: 23514
Gm16233
Name: predicted gene 16233
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 36,780,961 bp
  • T to C, chromosome 1 at 63,566,628 bp
  • T to C, chromosome 1 at 75,360,769 bp
  • T to C, chromosome 1 at 174,069,477 bp
  • G to A, chromosome 2 at 22,685,410 bp
  • T to C, chromosome 3 at 144,806,320 bp
  • A to G, chromosome 3 at 144,953,745 bp
  • C to T, chromosome 4 at 49,499,731 bp
  • A to G, chromosome 5 at 24,413,934 bp
  • A to T, chromosome 5 at 25,351,062 bp
  • A to G, chromosome 5 at 43,762,963 bp
  • T to C, chromosome 5 at 48,237,391 bp
  • A to G, chromosome 5 at 120,694,511 bp
  • C to A, chromosome 6 at 55,171,218 bp
  • A to T, chromosome 7 at 12,494,001 bp
  • G to A, chromosome 7 at 12,811,657 bp
  • A to G, chromosome 7 at 97,685,476 bp
  • C to T, chromosome 7 at 105,618,399 bp
  • T to G, chromosome 9 at 108,644,277 bp
  • T to A, chromosome 9 at 114,631,881 bp
  • A to G, chromosome 10 at 99,156,299 bp
  • G to A, chromosome 14 at 20,690,773 bp
  • G to C, chromosome 14 at 33,955,296 bp
  • T to A, chromosome 16 at 14,142,641 bp
  • T to C, chromosome 17 at 15,059,866 bp
  • G to C, chromosome 17 at 46,939,387 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to A, chromosome 17 at 87,689,138 bp
  • A to T, chromosome 19 at 16,701,165 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4383 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041123-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.