Strain Name:
C57BL/6J-MtgxR4512Btlr/Mmmh
Stock Number:
041587-MU
Citation ID:
RRID:MMRRC_041587-MU
Other Names:
R4512 (G1), C57BL/6J-MtgxR4512Btlr
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: TRP1, TRP-1, Oca3, Tyrp, isa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22178
Homologene: 464
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108664
Homologene: 7139
Odf2
Name: outer dense fiber of sperm tails 2
Synonyms: cenexin, MMTEST29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18286
HGNC: HGNC:8114
Homologene: 1907
Hspbap1
Name: Hspb associated protein 1
Synonyms: 3830421G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66667
VEGA: 16
Homologene: 11617
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 2410152H17Rik, 2900036C23Rik, 6030449K19Rik, 2810413I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66315
Homologene: 10778
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: AREB6, Zfhx1a, [delta]EF1, Tcf8, Zfhep, Tw, ZEB, Tcf18, MEB1, Nil2, Zfx1a, 3110032K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21417
Homologene: 31779
Rere
Name: arginine glutamic acid dipeptide (RE) repeats
Synonyms: eyes3, 1110033A15Rik, atrophin-2, Atr2, eyem03Jus
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68703
HGNC: HGNC:9965
Homologene: 8101
Smpd4
Name: sphingomyelin phosphodiesterase 4
Synonyms: neutral membrane (neutral sphingomyelinase-3), 4122402O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 77626
Homologene: 9813
Parg
Name: poly (ADP-ribose) glycohydrolase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 26430
Homologene: 50532
Zfp985
Name: zinc finger protein 985
Synonyms: Gm13154
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433804
Homologene: 133076
Susd1
Name: sushi domain containing 1
Synonyms: Gm12528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 634731
Homologene: 11204
Adgrg5
Name: adhesion G protein-coupled receptor G5
Synonyms: LOC382045, Gpr114, PGR27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382045
Homologene: 17828
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: 4432416O06Rik, m407Asp, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo, m152Asp, D030010H02Rik, DHC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Stk11
Name: serine/threonine kinase 11
Synonyms: Lkb1, Par-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20869
Homologene: 393
Vamp4
Name: vesicle-associated membrane protein 4
Synonyms: D1Ertd147e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 53330
Homologene: 37847
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Uncx
Name: UNC homeobox
Synonyms: Uncx4.1, Chx4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22255
Homologene: 56598
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Abcb4
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 4
Synonyms: Pgy2, Pgy-2, mdr-2, Mdr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Nav3
Name: neuron navigator 3
Synonyms: steerin 3, 4732483H20Rik, unc53H3, Pomfil1p, 9630020C08Rik, POMFIL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 260315
Homologene: 56688
Xpr1
Name: xenotropic and polytropic retrovirus receptor 1
Synonyms: Rmc1, suppressor of yeast Ga deletion, Syg1, Rmc-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19775
Homologene: 134226
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Otud7a
Name: OTU domain containing 7A
Synonyms: Cezanne 2 protein, Otud7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170711
Homologene: 15642
BC016579
Name: cDNA sequence, BC016579
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212998
VEGA: 16
Homologene: 11622
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Vmn2r78
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637896
Homologene: 115466
Slc16a7
Name: solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms: 9030411M13Rik, 4921534N07Rik, MCT2, D630004K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20503
Homologene: 20990
Gcc1
Name: golgi coiled coil 1
Synonyms: 4932417P04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74375
Homologene: 11567
Spsb3
Name: splA/ryanodine receptor domain and SOCS box containing 3
Synonyms: 2310012N15Rik, 3300001M01Rik, Tce1, SSB3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 79043
Homologene: 12322
Pam
Name: peptidylglycine alpha-amidating monooxygenase
Synonyms: PHM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18484
HGNC: HGNC:8596
Homologene: 37369
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: Dnaic2, C030015H18Rik, b2b3405Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432611
Homologene: 11311
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: Type IV PLA2, Pla2g4, cytosolic phospholipase A2, cytosolic PLA2, cPLA2, cPLA2alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Psd4
Name: pleckstrin and Sec7 domain containing 4
Synonyms: EFA6B, SEC7 homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 215632
Homologene: 8261
Tph1
Name: tryptophan hydroxylase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21990
Homologene: 121565
Lmln
Name: leishmanolysin-like (metallopeptidase M8 family)
Synonyms: 5330415H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239833
Homologene: 13198
Ces4a
Name: carboxylesterase 4A
Synonyms: Ces8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234677
Homologene: 71949
Mark1
Name: MAP/microtubule affinity regulating kinase 1
Synonyms: Emk3, B930025N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226778
HGNC: HGNC:6896
Homologene: 49552
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl1, Psgl-1, CD162
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20345
Homologene: 2261
Fhl4
Name: four and a half LIM domains 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14202
VEGA: 10
HGNC: HGNC:3702
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71481
Homologene: 11849
St6gal2
Name: beta galactoside alpha 2,6 sialyltransferase 2
Synonyms: ST6Gal II, C230064G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240119
Homologene: 13052
Mrpl40
Name: mitochondrial ribosomal protein L40
Synonyms: Nlvcf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18100
Homologene: 2800
Or4n4b
Name: olfactory receptor family 4 subfamily N member 4B
Synonyms: MOR241-2, Olfr733, GA_x6K02T2PMLR-5992342-5991416
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258657
Homologene: 128266
Aup1
Name: ancient ubiquitous protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11993
HGNC: HGNC:891
Homologene: 7239
Or5m3b
Name: olfactory receptor family 5 subfamily M member 3B
Synonyms: Olfr1033, GA_x6K02T2Q125-47516301-47517233, MOR199-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258571
Homologene: 138314
Or51t4
Name: olfactory receptor family 51 subfamily T member 4
Synonyms: MOR14-9, Olfr574, GA_x6K02T2PBJ9-5659738-5660748
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258357
Homologene: 27137
Cenpn
Name: centromere protein N
Synonyms: 2610510J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72155
Homologene: 12450
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194231
Homologene: 4604
Ly6e
Name: lymphocyte antigen 6 family member E
Synonyms: Ly67, RIG-E, Sca-2, 9804, Tsa1, TSA-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17069
HGNC: HGNC:6727
Homologene: 56411
Tmprss11a
Name: transmembrane protease, serine 11a
Synonyms: LOC194597
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 194597
Homologene: 62723
Oard1
Name: O-acyl-ADP-ribose deacylase 1
Synonyms: AI314976
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106821
VEGA: 17
Homologene: 17038
Nfkbie
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18037
VEGA: 17
HGNC: HGNC:7799
Homologene: 36160
R3hcc1
Name: R3H domain and coiled-coil containing 1
Synonyms: 1700020M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71843
Homologene: 136250
Pttg1ip
Name: pituitary tumor-transforming 1 interacting protein
Synonyms: 1810010L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 108705
Homologene: 3203
Smim3
Name: small integral membrane protein 3
Synonyms: 2010002N04Rik, cI-41, Nid67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106878
VEGA: 18
Homologene: 13167
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 5,098,135 bp
  • T to C, chromosome 1 at 97,975,854 bp
  • T to A, chromosome 1 at 149,861,051 bp
  • C to T, chromosome 1 at 155,332,328 bp
  • A to T, chromosome 1 at 162,577,888 bp
  • C to A, chromosome 1 at 184,907,089 bp
  • C to T, chromosome 2 at 24,402,889 bp
  • C to T, chromosome 2 at 29,926,097 bp
  • T to C, chromosome 2 at 76,750,470 bp
  • C to A, chromosome 2 at 76,898,625 bp
  • T to C, chromosome 2 at 86,041,569 bp
  • T to C, chromosome 3 at 104,089,555 bp
  • T to C, chromosome 3 at 123,671,666 bp
  • T to C, chromosome 3 at 127,684,471 bp
  • A to T, chromosome 4 at 59,329,491 bp
  • G to T, chromosome 4 at 80,837,512 bp
  • T to C, chromosome 4 at 134,228,534 bp
  • G to A, chromosome 4 at 147,583,563 bp
  • T to A, chromosome 4 at 150,477,452 bp
  • A to T, chromosome 5 at 8,928,573 bp
  • A to G, chromosome 5 at 86,428,578 bp
  • A to G, chromosome 5 at 113,819,063 bp
  • A to G, chromosome 5 at 139,546,767 bp
  • T to C, chromosome 6 at 28,419,209 bp
  • C to T, chromosome 6 at 83,056,387 bp
  • G to A, chromosome 7 at 46,656,897 bp
  • T to C, chromosome 7 at 63,729,877 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • C to T, chromosome 7 at 86,920,244 bp
  • T to C, chromosome 7 at 102,948,738 bp
  • T to C, chromosome 8 at 94,934,024 bp
  • G to A, chromosome 8 at 105,138,097 bp
  • A to G, chromosome 8 at 116,933,396 bp
  • A to T, chromosome 9 at 7,085,009 bp
  • T to C, chromosome 10 at 77,597,068 bp
  • T to C, chromosome 10 at 80,126,377 bp
  • A to G, chromosome 10 at 85,098,714 bp
  • T to C, chromosome 10 at 109,694,082 bp
  • T to G, chromosome 10 at 125,233,439 bp
  • T to C, chromosome 11 at 114,750,535 bp
  • A to T, chromosome 13 at 63,156,667 bp
  • T to C, chromosome 14 at 32,262,736 bp
  • C to A, chromosome 14 at 50,298,996 bp
  • A to G, chromosome 14 at 69,698,611 bp
  • T to C, chromosome 14 at 123,295,448 bp
  • T to A, chromosome 15 at 74,957,833 bp
  • A to G, chromosome 15 at 76,297,955 bp
  • C to A, chromosome 16 at 17,629,121 bp
  • T to C, chromosome 16 at 18,872,558 bp
  • G to A, chromosome 16 at 33,088,137 bp
  • C to T, chromosome 16 at 35,787,241 bp
  • C to A, chromosome 16 at 45,633,000 bp
  • T to G, chromosome 16 at 56,165,883 bp
  • A to G, chromosome 17 at 24,890,296 bp
  • C to T, chromosome 17 at 45,556,239 bp
  • A to G, chromosome 17 at 48,416,760 bp
  • A to T, chromosome 17 at 55,483,017 bp
  • G to A, chromosome 18 at 5,759,007 bp
  • A to G, chromosome 18 at 59,410,187 bp
  • A to T, chromosome 18 at 60,475,484 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4512 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041587-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.