Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4512Btlr/Mmmh
Stock Number:
041587-MU
Citation ID:
RRID:MMRRC_041587-MU
Other Names:
R4512 (G1), C57BL/6J-MtgxR4512Btlr
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Hspbap1
Name: Hspb associated protein 1
Synonyms: 3830421G21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66667
VEGA: 16
Homologene: 11617
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 5,098,135 bp
  • T to C, chromosome 1 at 97,975,854 bp
  • T to A, chromosome 1 at 149,861,051 bp
  • C to T, chromosome 1 at 155,332,328 bp
  • A to T, chromosome 1 at 162,577,888 bp
  • C to A, chromosome 1 at 184,907,089 bp
  • C to T, chromosome 2 at 24,402,889 bp
  • C to T, chromosome 2 at 29,926,097 bp
  • T to C, chromosome 2 at 76,750,470 bp
  • C to A, chromosome 2 at 76,898,625 bp
  • T to C, chromosome 2 at 86,041,569 bp
  • T to C, chromosome 3 at 104,089,555 bp
  • T to C, chromosome 3 at 123,671,666 bp
  • T to C, chromosome 3 at 127,684,471 bp
  • A to T, chromosome 4 at 59,329,491 bp
  • G to T, chromosome 4 at 80,837,512 bp
  • T to C, chromosome 4 at 134,228,534 bp
  • G to A, chromosome 4 at 147,583,563 bp
  • T to A, chromosome 4 at 150,477,452 bp
  • A to T, chromosome 5 at 8,928,573 bp
  • A to G, chromosome 5 at 86,428,578 bp
  • A to G, chromosome 5 at 113,819,063 bp
  • A to G, chromosome 5 at 139,546,767 bp
  • T to C, chromosome 6 at 28,419,209 bp
  • C to T, chromosome 6 at 83,056,387 bp
  • G to A, chromosome 7 at 46,656,897 bp
  • T to C, chromosome 7 at 63,729,877 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • C to T, chromosome 7 at 86,920,244 bp
  • T to C, chromosome 7 at 102,948,738 bp
  • T to C, chromosome 8 at 94,934,024 bp
  • G to A, chromosome 8 at 105,138,097 bp
  • A to G, chromosome 8 at 116,933,396 bp
  • A to T, chromosome 9 at 7,085,009 bp
  • T to C, chromosome 10 at 77,597,068 bp
  • T to C, chromosome 10 at 80,126,377 bp
  • A to G, chromosome 10 at 85,098,714 bp
  • T to C, chromosome 10 at 109,694,082 bp
  • T to G, chromosome 10 at 125,233,439 bp
  • T to C, chromosome 11 at 114,750,535 bp
  • A to T, chromosome 13 at 63,156,667 bp
  • T to C, chromosome 14 at 32,262,736 bp
  • C to A, chromosome 14 at 50,298,996 bp
  • A to G, chromosome 14 at 69,698,611 bp
  • T to C, chromosome 14 at 123,295,448 bp
  • T to A, chromosome 15 at 74,957,833 bp
  • A to G, chromosome 15 at 76,297,955 bp
  • C to A, chromosome 16 at 17,629,121 bp
  • T to C, chromosome 16 at 18,872,558 bp
  • G to A, chromosome 16 at 33,088,137 bp
  • C to T, chromosome 16 at 35,787,241 bp
  • C to A, chromosome 16 at 45,633,000 bp
  • T to G, chromosome 16 at 56,165,883 bp
  • A to G, chromosome 17 at 24,890,296 bp
  • C to T, chromosome 17 at 45,556,239 bp
  • A to G, chromosome 17 at 48,416,760 bp
  • A to T, chromosome 17 at 55,483,017 bp
  • G to A, chromosome 18 at 5,759,007 bp
  • A to G, chromosome 18 at 59,410,187 bp
  • A to T, chromosome 18 at 60,475,484 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4512 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041587-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.