Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3982Btlr/Mmmh
Stock Number:
041608-MU
Citation ID:
RRID:MMRRC_041608-MU
Other Names:
R3982 (G1), C57BL/6J-MtgxR3982Btlr
Major Collection:

Strain Information

Hapln1
Name: hyaluronan and proteoglycan link protein 1
Synonyms: link protein, cartilage linking protein 1, Crtl1l, Crtl1, CLP, LP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12950
VEGA: 13
HGNC: HGNC:2380
Homologene: 1420
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Prpf4b
Name: pre-mRNA processing factor 4B
Synonyms: Prp4, Prpk, Prp4k
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19134
VEGA: 13
Homologene: 134085
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: MLTKbeta, MLTKalpha, B230120H23Rik, Zak
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Nifk
Name: nucleolar protein interacting with the FHA domain of MKI67
Synonyms: C130020J04Rik, Mki67ip
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67949
Homologene: 49862
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Frmd6
Name: FERM domain containing 6
Synonyms: 2610019M19Rik, 4930488L10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319710
VEGA: 12
Homologene: 12449
Pigo
Name: phosphatidylinositol glycan anchor biosynthesis, class O
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56703
Homologene: 31761
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Kcp
Name: kielin/chordin-like protein
Synonyms: LOC333088, KCP, Crim2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 333088
Homologene: 87817
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Palmd
Name: palmdelphin
Synonyms: PALML, 4631423C22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 114301
Homologene: 9804
Polg2
Name: polymerase (DNA directed), gamma 2, accessory subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50776
HGNC: HGNC:9180
Homologene: 5221
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: cpd2, A230044C21Rik, Caps2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320405
Homologene: 23060
Plag1
Name: pleiomorphic adenoma gene 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56711
HGNC: HGNC:9045
Homologene: 1993
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215798
Homologene: 10724
Thoc2l
Name: THO complex subunit 2-like
Synonyms: Gm3179, BC005561
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100042165
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Clca1
Name: chloride channel accessory 1
Synonyms: gob-5, gob5, Clca3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23844
HGNC: HGNC:2015
Homologene: 984
Cth
Name: cystathionine gamma lyase
Synonyms: 0610010I13Rik, CSE
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 107869
HGNC: HGNC:2501
Homologene: 1432
Man2b2
Name: mannosidase 2, alpha B2
Synonyms: 135 kDa alpha-D-mannosidase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17160
Homologene: 7411
Klre1
Name: killer cell lectin-like receptor family E member 1
Synonyms: Klre-1, NKG2I
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243655
Homologene: 17794
4921504E06Rik
Name: RIKEN cDNA 4921504E06 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70909
Homologene: 87049
Atf4
Name: activating transcription factor 4
Synonyms: TAXREB67, C/ATF, CREB2, Atf-4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11911
VEGA: 15
HGNC: HGNC:786
Homologene: 1266
Mmd2
Name: monocyte to macrophage differentiation-associated 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75104
Homologene: 18425
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 118,329,552 bp
  • A to G, chromosome 2 at 12,300,963 bp
  • A to G, chromosome 2 at 19,542,369 bp
  • C to T, chromosome 2 at 72,438,227 bp
  • ACCTCCTCCTCCTCCTCCTC to ACCTCCTCCTCCTCCTC, chromosome 2 at 76,843,390 bp
  • T to A, chromosome 3 at 63,328,064 bp
  • T to C, chromosome 3 at 116,923,823 bp
  • T to A, chromosome 3 at 144,755,309 bp
  • A to T, chromosome 3 at 157,913,697 bp
  • A to T, chromosome 4 at 3,904,055 bp
  • A to T, chromosome 4 at 43,023,482 bp
  • G to A, chromosome 4 at 106,387,883 bp
  • T to C, chromosome 5 at 36,813,820 bp
  • A to G, chromosome 5 at 81,694,526 bp
  • T to C, chromosome 5 at 104,521,023 bp
  • T to C, chromosome 5 at 142,564,799 bp
  • A to G, chromosome 6 at 23,263,531 bp
  • G to A, chromosome 6 at 29,442,941 bp
  • A to T, chromosome 6 at 29,484,637 bp
  • A to T, chromosome 6 at 40,455,241 bp
  • T to A, chromosome 6 at 129,583,138 bp
  • T to C, chromosome 7 at 10,714,431 bp
  • G to A, chromosome 9 at 99,046,601 bp
  • T to C, chromosome 9 at 108,107,166 bp
  • T to C, chromosome 10 at 14,448,845 bp
  • T to A, chromosome 10 at 107,543,396 bp
  • G to A, chromosome 11 at 106,779,202 bp
  • T to C, chromosome 12 at 70,887,834 bp
  • A to T, chromosome 12 at 114,914,631 bp
  • C to T, chromosome 13 at 34,884,213 bp
  • T to A, chromosome 13 at 89,605,441 bp
  • T to C, chromosome 15 at 80,256,868 bp
  • T to A, chromosome 15 at 91,709,284 bp
  • T to A, chromosome 17 at 23,359,974 bp
  • C to A, chromosome 17 at 29,931,264 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3982 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text