Strain Name:
C57BL/6J-MtgxR4334Btlr/Mmmh
Stock Number:
041664-MU
Citation ID:
RRID:MMRRC_041664-MU
Other Names:
R4334 (G1), C57BL/6J-MtgxR4334Btlr
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Htr3b
Name: 5-hydroxytryptamine (serotonin) receptor 3B
Synonyms: 5-HT3 receptor subunit B, 5-HT3B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57014
VEGA: 9
HGNC: HGNC:5298
Homologene: 38131
Foxm1
Name: forkhead box M1
Synonyms: Mpm2, Fkh16, Trident, HFH-11B, Foxm1b, WIN
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14235
HGNC: HGNC:3818
Homologene: 7318
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Orc1
Name: origin recognition complex, subunit 1
Synonyms: Orc1l, MmORC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Adcyap1
Name: adenylate cyclase activating polypeptide 1
Synonyms: PACAP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11516
VEGA: 17
HGNC: HGNC:241
Homologene: 869
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Drosha
Name: drosha, ribonuclease type III
Synonyms: 1110013A17Rik, Etohi2, Rnasen
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14000
Homologene: 8293
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: rjs, D7H15F32S1, D7H15F37S1, jdf2, D15F32S1h
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Fkbp15
Name: FK506 binding protein 15
Synonyms: C430014M02Rik, FKBP133
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338355
Homologene: 28743
Tmprss6
Name: transmembrane serine protease 6
Synonyms: matriptase-2, 1300008A22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71753
VEGA: 15
Homologene: 12408
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: 2610301F02Rik, ENSMUSG00000075261, CAMDI
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Dsp
Name: desmoplakin
Synonyms: 2300002E22Rik, rul, DP, 5730453H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Enpp3
Name: ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms: CD203c
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209558
VEGA: 10
HGNC: HGNC:3358
Homologene: 3683
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Notch1
Name: notch 1
Synonyms: Mis6, Tan1, N1, lin-12, Motch A, 9930111A19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18128
HGNC: HGNC:7881
Homologene: 32049
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: glucocorticoid receptor-interacting protein 1, bHLHe75, TIF-2, TIF2, D1Ertd433e, KAT13C, SRC-2, TIF2/GRIP-1, Grip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17978
HGNC: HGNC:7669
Homologene: 4768
Wdr4
Name: WD repeat domain 4
Synonyms: Wh, D530049K22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57773
Homologene: 32422
Fhdc1
Name: FH2 domain containing 1
Synonyms: 6330505N24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229474
Homologene: 18920
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: nmf181, 4930542A03Rik, nmf112, bob, nmf252, mdfw, USH1D, sals, ahl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Cfi
Name: complement component factor i
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12630
HGNC: HGNC:5394
Homologene: 171
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: prh, D3Ertd789e, b2b1304Clo, b2b2025.1Clo, 4921507O14Rik, b2b1735Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Unc79
Name: unc-79 homolog
Synonyms: Mlca3, 9030205A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Ssc5d
Name: scavenger receptor cysteine rich family, 5 domains
Synonyms: A430110N23Rik, s5d-srcrb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269855
Homologene: 77555
Foxa2
Name: forkhead box A2
Synonyms: HNF3-beta, Hnf-3b, Hnf3b, HNF3beta, Tcf3b, Tcf-3b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15376
HGNC: HGNC:5022
Homologene: 7762
Vmn2r118
Name: vomeronasal 2, receptor 118
Synonyms: EG383258, Vmn2r119, EG668547
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383258
Homologene: 129687
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Gpatch3
Name: G patch domain containing 3
Synonyms: D930035B09Rik, Gpatc3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242691
Homologene: 11122
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: TCF9, LOC381696, D430033A06Rik, 1700012H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
Kng1
Name: kininogen 1
Synonyms: L-kininogen, H-kininigen
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16644
HGNC: HGNC:6383
Homologene: 88343
Vmn2r71
Name: vomeronasal 2, receptor 71
Synonyms: EG233445
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233445
Homologene: 115466
Clstn2
Name: calsyntenin 2
Synonyms: CSTN2, 2900042C18Rik, Cst-2, CS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
B4galt4
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms: 9130402O08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56375
HGNC: HGNC:927
Homologene: 37848
Rab3a
Name: RAB3A, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19339
HGNC: HGNC:9777
Homologene: 20629
Sh3tc2
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Zfp810
Name: zinc finger protein 810
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235050
VEGA: 9
Homologene: 138299
Micall2
Name: MICAL-like 2
Synonyms: A930021H16Rik, Jrab, MICAL-L2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231830
Homologene: 85155
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 13,174,963 bp
  • T to A, chromosome 1 at 185,303,394 bp
  • G to A, chromosome 2 at 26,460,036 bp
  • C to T, chromosome 2 at 77,170,432 bp
  • C to T, chromosome 2 at 91,140,572 bp
  • T to C, chromosome 2 at 148,044,703 bp
  • A to G, chromosome 3 at 33,837,882 bp
  • C to A, chromosome 3 at 84,444,826 bp
  • T to A, chromosome 3 at 129,850,829 bp
  • G to A, chromosome 4 at 62,303,219 bp
  • A to G, chromosome 4 at 108,579,432 bp
  • A to G, chromosome 4 at 133,582,481 bp
  • A to G, chromosome 5 at 43,683,134 bp
  • T to C, chromosome 5 at 72,550,262 bp
  • C to T, chromosome 5 at 110,789,357 bp
  • T to C, chromosome 5 at 139,713,350 bp
  • AT to ATT, chromosome 6 at 113,111,320 bp
  • T to C, chromosome 6 at 128,365,967 bp
  • T to C, chromosome 7 at 4,943,664 bp
  • T to C, chromosome 7 at 56,226,654 bp
  • T to C, chromosome 7 at 85,619,834 bp
  • T to A, chromosome 8 at 70,749,826 bp
  • T to C, chromosome 9 at 22,278,784 bp
  • G to A, chromosome 9 at 48,945,509 bp
  • T to G, chromosome 9 at 97,463,528 bp
  • A to G, chromosome 9 at 99,061,851 bp
  • A to T, chromosome 10 at 24,793,589 bp
  • T to A, chromosome 10 at 58,463,994 bp
  • G to T, chromosome 10 at 60,385,059 bp
  • C to T, chromosome 12 at 103,078,974 bp
  • A to G, chromosome 13 at 38,196,664 bp
  • A to T, chromosome 14 at 4,514,779 bp
  • A to G, chromosome 14 at 55,894,042 bp
  • G to A, chromosome 15 at 12,827,273 bp
  • T to A, chromosome 15 at 78,459,427 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 23,079,620 bp
  • T to C, chromosome 16 at 38,752,259 bp
  • A to T, chromosome 17 at 24,318,268 bp
  • A to T, chromosome 17 at 31,499,152 bp
  • A to T, chromosome 17 at 45,410,786 bp
  • A to T, chromosome 17 at 55,610,347 bp
  • G to A, chromosome 17 at 74,352,015 bp
  • T to C, chromosome 17 at 93,202,268 bp
  • A to G, chromosome 18 at 31,976,987 bp
  • A to G, chromosome 18 at 61,990,321 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4334 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041664-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.