Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4334Btlr/Mmmh
Stock Number:
041664-MU
Citation ID:
RRID:MMRRC_041664-MU
Other Names:
R4334 (G1), C57BL/6J-MtgxR4334Btlr
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Htr3b
Name: 5-hydroxytryptamine (serotonin) receptor 3B
Synonyms: 5-HT3 receptor subunit B, 5-HT3B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57014
VEGA: 9
HGNC: HGNC:5298
Homologene: 38131
Foxm1
Name: forkhead box M1
Synonyms: Mpm2, WIN, HFH-11B, Trident, Fkh16, Foxm1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14235
HGNC: HGNC:3818
Homologene: 7318
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Adcyap1
Name: adenylate cyclase activating polypeptide 1
Synonyms: PACAP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11516
VEGA: 17
HGNC: HGNC:241
Homologene: 869
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 13,174,963 bp
  • T to A, chromosome 1 at 185,303,394 bp
  • G to A, chromosome 2 at 26,460,036 bp
  • C to T, chromosome 2 at 77,170,432 bp
  • C to T, chromosome 2 at 91,140,572 bp
  • T to C, chromosome 2 at 148,044,703 bp
  • A to G, chromosome 3 at 33,837,882 bp
  • C to A, chromosome 3 at 84,444,826 bp
  • T to A, chromosome 3 at 129,850,829 bp
  • G to A, chromosome 4 at 62,303,219 bp
  • A to G, chromosome 4 at 108,579,432 bp
  • A to G, chromosome 4 at 133,582,481 bp
  • A to G, chromosome 5 at 43,683,134 bp
  • T to C, chromosome 5 at 72,550,262 bp
  • C to T, chromosome 5 at 110,789,357 bp
  • T to C, chromosome 5 at 139,713,350 bp
  • AT to ATT, chromosome 6 at 113,111,320 bp
  • T to C, chromosome 6 at 128,365,967 bp
  • T to C, chromosome 7 at 4,943,664 bp
  • T to C, chromosome 7 at 56,226,654 bp
  • T to C, chromosome 7 at 85,619,834 bp
  • T to A, chromosome 8 at 70,749,826 bp
  • T to C, chromosome 9 at 22,278,784 bp
  • G to A, chromosome 9 at 48,945,509 bp
  • T to G, chromosome 9 at 97,463,528 bp
  • A to G, chromosome 9 at 99,061,851 bp
  • A to T, chromosome 10 at 24,793,589 bp
  • T to A, chromosome 10 at 58,463,994 bp
  • G to T, chromosome 10 at 60,385,059 bp
  • C to T, chromosome 12 at 103,078,974 bp
  • A to G, chromosome 13 at 38,196,664 bp
  • A to T, chromosome 14 at 4,514,779 bp
  • A to G, chromosome 14 at 55,894,042 bp
  • G to A, chromosome 15 at 12,827,273 bp
  • T to A, chromosome 15 at 78,459,427 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 23,079,620 bp
  • T to C, chromosome 16 at 38,752,259 bp
  • A to T, chromosome 17 at 24,318,268 bp
  • A to T, chromosome 17 at 31,499,152 bp
  • A to T, chromosome 17 at 45,410,786 bp
  • A to T, chromosome 17 at 55,610,347 bp
  • G to A, chromosome 17 at 74,352,015 bp
  • T to C, chromosome 17 at 93,202,268 bp
  • A to G, chromosome 18 at 31,976,987 bp
  • A to G, chromosome 18 at 61,990,321 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4334 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041664-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.