Strain Name:
C57BL/6J-MtgxR4477Btlr/Mmmh
Stock Number:
041734-MU
Citation ID:
RRID:MMRRC_041734-MU
Other Names:
R4477 (G1), C57BL/6J-MtgxR4477Btlr
Major Collection:

Gene Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Katna1
Name: katanin p60 (ATPase-containing) subunit A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 23924
HGNC: HGNC:6216
Homologene: 56014
Pdlim5
Name: PDZ and LIM domain 5
Synonyms: Enh3, Enh2, Enh, 1110001A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56376
Homologene: 21289
Nup35
Name: nucleoporin 35
Synonyms: 5330402E05Rik, 2310006I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69482
Homologene: 44517
Sdad1
Name: SDA1 domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231452
Homologene: 6036
Agfg1
Name: ArfGAP with FG repeats 1
Synonyms: Rip, C130049H11Rik, D730048C23Rik, Hrb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15463
HGNC: HGNC:5175
Homologene: 37929
Bicd2
Name: BICD cargo adaptor 2
Synonyms: 0610027D24Rik, 1110005D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76895
VEGA: 13
Homologene: 9070
Nkiras2
Name: NFKB inhibitor interacting Ras-like protein 2
Synonyms: 4930527H08Rik, KBRAS2, 2410003M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71966
Homologene: 9738
Syt9
Name: synaptotagmin IX
Synonyms: Sytv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 60510
Homologene: 11062
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22031
Homologene: 7981
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 209018
Homologene: 44592
Neo1
Name: neogenin
Synonyms: D930014N22Rik, 2610028H22Rik, Igdcc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Eif4g1
Name: eukaryotic translation initiation factor 4, gamma 1
Synonyms: E030015G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208643
HGNC: HGNC:3296
Homologene: 110725
Inpp5j
Name: inositol polyphosphate 5-phosphatase J
Synonyms: Pipp, Pib5pa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 170835
HGNC: HGNC:8956
Homologene: 8682
Pom121
Name: nuclear pore membrane protein 121
Synonyms: 2610027A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 107939
Homologene: 70878
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67661
Homologene: 15202
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Abcg4
Name: ATP binding cassette subfamily G member 4
Synonyms: 6430517O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 192663
Homologene: 75179
Dbn1
Name: drebrin 1
Synonyms: drebrin E2, drebrin A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Zfp770
Name: zinc finger protein 770
Synonyms: 6430601A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228491
Homologene: 82354
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 435864
Homologene: 129606
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 231002
VEGA: 4
Homologene: 12949
C5ar1
Name: complement component 5a receptor 1
Synonyms: C5aR, Cd88, C5r1, D7Msu1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12273
HGNC: HGNC:1338
Homologene: 20413
D130040H23Rik
Name: RIKEN cDNA D130040H23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 211135
Homologene: 138403
Ap1m2
Name: adaptor protein complex AP-1, mu 2 subunit
Synonyms: [m]1B, mu1B, D9Ertd818e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11768
VEGA: 9
HGNC: HGNC:558
Homologene: 55906
Mmp19
Name: matrix metallopeptidase 19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 58223
VEGA: 10
HGNC: HGNC:7165
Homologene: 1820
Angpt1
Name: angiopoietin 1
Synonyms: Ang-1, Angiopoietin-1, 1110046O21Rik, ang1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11600
VEGA: 15
HGNC: HGNC:484
Homologene: 37447
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Cdh15
Name: cadherin 15
Synonyms: Cdh14, Mcad, M cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Pramel20
Name: PRAME like 20
Synonyms: BC080695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329986
Homologene: 83161
Lrrc71
Name: leucine rich repeat containing 71
Synonyms: 4933430H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74485
Homologene: 83646
Pla2g4f
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271844
Homologene: 77933
AK157302
Name: cDNA sequence AK157302
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 432732
Gm3159
Name: predicted gene 3159
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100041139
Homologene: 115686
Gm7138
Name: predicted gene 7138
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 102640500
VEGA: 10
Homologene: 115744
Rasgef1a
Name: RasGEF domain family, member 1A
Synonyms: 6330404M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70727
Homologene: 17067
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 82,875,340 bp
  • T to C, chromosome 2 at 80,657,143 bp
  • T to A, chromosome 2 at 113,444,399 bp
  • G to A, chromosome 2 at 114,196,884 bp
  • A to G, chromosome 2 at 120,303,672 bp
  • G to C, chromosome 3 at 87,742,665 bp
  • C to T, chromosome 3 at 142,259,217 bp
  • A to G, chromosome 4 at 143,571,162 bp
  • G to A, chromosome 4 at 156,223,399 bp
  • C to T, chromosome 5 at 31,265,437 bp
  • A to G, chromosome 5 at 92,297,160 bp
  • T to C, chromosome 5 at 108,846,277 bp
  • T to C, chromosome 5 at 135,381,988 bp
  • A to T, chromosome 6 at 118,085,475 bp
  • C to T, chromosome 6 at 118,630,239 bp
  • T to C, chromosome 7 at 16,248,864 bp
  • A to G, chromosome 7 at 107,425,221 bp
  • C to A, chromosome 8 at 69,302,503 bp
  • A to G, chromosome 8 at 122,864,676 bp
  • A to G, chromosome 9 at 21,298,213 bp
  • A to G, chromosome 9 at 44,275,086 bp
  • T to C, chromosome 9 at 58,877,299 bp
  • T to C, chromosome 10 at 7,738,830 bp
  • A to T, chromosome 10 at 77,776,412 bp
  • A to T, chromosome 10 at 128,795,637 bp
  • T to C, chromosome 11 at 3,501,625 bp
  • T to C, chromosome 11 at 59,131,646 bp
  • C to T, chromosome 11 at 100,626,017 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to C, chromosome 12 at 111,248,602 bp
  • G to A, chromosome 13 at 13,635,383 bp
  • T to A, chromosome 13 at 21,495,691 bp
  • T to A, chromosome 13 at 49,377,972 bp
  • CCCGCTCCCGGTAGCGCCGCTC to CCCGCTC, chromosome 13 at 55,481,561 bp
  • T to C, chromosome 14 at 4,398,584 bp
  • A to G, chromosome 15 at 42,468,164 bp
  • G to T, chromosome 16 at 20,678,843 bp
  • A to T, chromosome 16 at 21,545,236 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4477 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041734-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.