Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4723Btlr/Mmmh
Stock Number:
041959-MU
Citation ID:
RRID:MMRRC_041959-MU
Other Names:
R4723 (G1), C57BL/6J-MtgxR4723Btlr
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Cmtm7
Name: CKLF-like MARVEL transmembrane domain containing 7
Synonyms: Cklfsf7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102545
VEGA: 9
Homologene: 15882
Cdc6
Name: cell division cycle 6
Synonyms: cell division cycle 18 homolog (S.pombe)-like, CDC18L, CDC18(S.pombe)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23834
HGNC: HGNC:1744
Homologene: 68172
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Smurf1
Name: SMAD specific E3 ubiquitin protein ligase 1
Synonyms: 4930431E10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75788
Homologene: 10712
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: B230217J03Rik, 9330189K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Ccdc167
Name: coiled-coil domain containing 167
Synonyms: 1110021J02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68597
Homologene: 79796
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22031
Homologene: 7981
Dmap1
Name: DNA methyltransferase 1-associated protein 1
Synonyms: 1500016M21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66233
Homologene: 41311
Myo1d
Name: myosin ID
Synonyms: 9930104H07Rik, D11Ertd9e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338367
HGNC: HGNC:7598
Homologene: 45576
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Slc10a4
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231290
Homologene: 15495
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231128
Homologene: 2746
Bcr
Name: BCR activator of RhoGEF and GTPase
Synonyms: 5133400C09Rik, breakpoint cluster region
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110279
VEGA: 10
HGNC: HGNC:1014
Homologene: 3192
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK-beta, IKK-2, IKK2, IKK[b], IKKbeta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Copg2
Name: coatomer protein complex, subunit gamma 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54160
HGNC: HGNC:2237
Homologene: 56292
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: Tsg118, 2310008H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66967
Homologene: 11866
Lrch3
Name: leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms: LOC385628, 2210409B11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70144
Homologene: 13111
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Grin1
Name: glutamate receptor, ionotropic, NMDA1 (zeta 1)
Synonyms: NMDAR1, NR1, Nmdar, M100174, GluRzeta1, Rgsc174
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14810
HGNC: HGNC:4584
Homologene: 7187
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Hyk, Tie2, Cd202b, tie-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Rnase9
Name: ribonuclease, RNase A family, 9 (non-active)
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328401
VEGA: 14
Homologene: 18830
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Rev-1, Rec-1, Atrc-1, Atrc1, 4831426K01Rik, mCAT-1, Cat1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11987
Homologene: 20658
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Gas6
Name: growth arrest specific 6
Synonyms: growth arrest-specific, GAS 6, Gas-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Akna
Name: AT-hook transcription factor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100182
Homologene: 49947
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227377
Homologene: 8877
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Opn5
Name: opsin 5
Synonyms: PGR12, Neuropsin, Gpr136, TMEM13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 353344
VEGA: 17
Homologene: 72341
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Mkrn2
Name: makorin, ring finger protein, 2
Synonyms: 2610002L04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67027
HGNC: HGNC:7113
Homologene: 8392
Txlnb
Name: taxilin beta
Synonyms: Mdp77, 2310001N14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 378431
Homologene: 44534
Lhcgr
Name: luteinizing hormone/choriogonadotropin receptor
Synonyms: Lhr, Gpcr19-rs1, LH-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16867
VEGA: 17
HGNC: HGNC:6585
Homologene: 37276
Sox30
Name: SRY (sex determining region Y)-box 30
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214105
Homologene: 34027
Mbl1
Name: mannose-binding lectin (protein A) 1
Synonyms: MBL-A, MBP-A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17194
VEGA: 14
HGNC: HGNC:6921
Homologene: 55449
Atp1a2
Name: ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms: Atpa-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98660
HGNC: HGNC:800
Homologene: 47947
Vmn2r98
Name: vomeronasal 2, receptor 98
Synonyms: EG224552
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224552
Homologene: 115024
Or52p1
Name: olfactory receptor family 52 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-7245486-7246451, MOR27-1, Olfr656
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259078
Homologene: 128072
Mfsd2b
Name: MFSD2 lysolipid transporter B, sphingolipid
Synonyms: major facilitator superfamily domain containing 2B, Gm1964
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432628
Homologene: 47753
Hsdl2
Name: hydroxysteroid dehydrogenase like 2
Synonyms: 2610207I16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72479
Iqce
Name: IQ motif containing E
Synonyms: 1700028P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74239
Homologene: 49912
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Napg
Name: N-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms: SNARE, 2400003O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108123
HGNC: HGNC:7642
Homologene: 2838
Slc16a14
Name: solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms: 1110004H10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71781
Homologene: 34318
Hkdc1
Name: hexokinase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216019
Homologene: 128937
Prss56
Name: serine protease 56
Synonyms: Prss56, 1700027L20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69453
Homologene: 79885
Sult2b1
Name: sulfotransferase family, cytosolic, 2B, member 1
Synonyms: SULT2B, Gm5897
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54200
Homologene: 49487
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Skint4
Name: selection and upkeep of intraepithelial T cells 4
Synonyms: 9530098N22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320640
Tmem220
Name: transmembrane protein 220
Synonyms: A730055C05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338369
Homologene: 18579
Zbtb7a
Name: zinc finger and BTB domain containing 7a
Synonyms: 9030619K07Rik, 9130006G12Rik, Lrf, FBI-1, Zbtb7, Pokemon, Leukemia/lymphoma Related Factor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16969
Homologene: 7820
Exosc3
Name: exosome component 3
Synonyms: 2310005D06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66362
Homologene: 6867
Klk1b27
Name: kallikrein 1-related peptidase b27
Synonyms: mGK-27, Klk27, Klk21l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16619
HGNC: HGNC:6357
Homologene: 68141
Or13j1
Name: olfactory receptor family 13 subfamily J member 1
Synonyms: mOR17, MOR262-4, GA_x6K02T2N78B-16230286-16231224, Olfr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56015
Homologene: 10460
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: GA_x6K02T2PBJ9-11224559-11223615, MOR268-6, Olfr519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
Keap1
Name: kelch-like ECH-associated protein 1
Synonyms: ring canal protein, INrf2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50868
Homologene: 8184
Sprr1b
Name: small proline-rich protein 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20754
Homologene: 134537
Med8
Name: mediator complex subunit 8
Synonyms: ARC32, 2210021A15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 80509
Homologene: 10560
Gkn3
Name: gastrokine 3
Synonyms: 1190003M12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68888
Homologene: 87422
Echs1
Name: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 93747
HGNC: HGNC:3151
Homologene: 3018
Psmg3
Name: proteasome (prosome, macropain) assembly chaperone 3
Synonyms: 4930403H09Rik, 1810042K04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66506
Homologene: 11980
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Spag11a
Name: sperm associated antigen 11A
Synonyms: Ep2e, 9230111C08Rik, Bin1b, Spag11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 78128
Homologene: 14385
Obox3-ps8
Name: oocyte specific homeobox 3, pseudogene 8
Synonyms: Gm4830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224752
Cfap97d2
Name: CFAP97 domain containing 2
Synonyms: 4932443I19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 403185
Gm2423
Name: predicted gene 2423
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100039786
VEGA: 13
Homologene: 132185
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 84,913,020 bp
  • C to T, chromosome 1 at 87,185,337 bp
  • T to C, chromosome 1 at 93,580,899 bp
  • T to A, chromosome 1 at 151,804,698 bp
  • G to T, chromosome 1 at 172,279,756 bp
  • A to G, chromosome 1 at 181,825,659 bp
  • A to G, chromosome 1 at 185,315,979 bp
  • T to C, chromosome 2 at 25,294,470 bp
  • T to C, chromosome 2 at 52,720,950 bp
  • T to C, chromosome 3 at 33,813,078 bp
  • T to G, chromosome 3 at 92,437,293 bp
  • T to C, chromosome 4 at 43,705,785 bp
  • T to C, chromosome 4 at 45,319,642 bp
  • T to A, chromosome 4 at 59,593,270 bp
  • T to C, chromosome 4 at 63,387,032 bp
  • T to C, chromosome 4 at 94,799,160 bp
  • T to C, chromosome 4 at 112,118,236 bp
  • T to C, chromosome 4 at 117,676,039 bp
  • T to A, chromosome 4 at 118,411,801 bp
  • A to G, chromosome 5 at 34,420,786 bp
  • T to A, chromosome 5 at 73,012,055 bp
  • T to C, chromosome 5 at 120,766,256 bp
  • G to A, chromosome 5 at 139,826,370 bp
  • A to T, chromosome 5 at 140,686,086 bp
  • A to T, chromosome 5 at 144,893,184 bp
  • G to T, chromosome 5 at 148,335,440 bp
  • G to A, chromosome 6 at 30,896,434 bp
  • G to A, chromosome 6 at 83,031,257 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • T to A, chromosome 6 at 115,611,850 bp
  • A to T, chromosome 7 at 44,056,532 bp
  • T to A, chromosome 7 at 45,742,065 bp
  • C to G, chromosome 7 at 101,494,618 bp
  • T to C, chromosome 7 at 104,618,489 bp
  • A to T, chromosome 7 at 108,893,821 bp
  • G to A, chromosome 7 at 118,855,864 bp
  • A to G, chromosome 7 at 120,201,075 bp
  • A to C, chromosome 7 at 140,110,648 bp
  • A to G, chromosome 8 at 13,466,848 bp
  • A to T, chromosome 8 at 13,735,937 bp
  • G to A, chromosome 8 at 19,159,382 bp
  • A to T, chromosome 8 at 22,669,607 bp
  • C to T, chromosome 8 at 104,293,675 bp
  • T to C, chromosome 9 at 20,809,591 bp
  • G to T, chromosome 9 at 21,231,410 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 108,112,655 bp
  • G to A, chromosome 9 at 110,970,160 bp
  • A to C, chromosome 9 at 114,763,391 bp
  • A to G, chromosome 10 at 17,799,267 bp
  • A to G, chromosome 10 at 23,851,691 bp
  • T to C, chromosome 10 at 62,400,354 bp
  • T to A, chromosome 10 at 75,175,329 bp
  • G to A, chromosome 10 at 81,144,440 bp
  • G to A, chromosome 11 at 45,984,765 bp
  • A to G, chromosome 11 at 62,378,612 bp
  • A to G, chromosome 11 at 67,029,993 bp
  • A to G, chromosome 11 at 80,779,841 bp
  • G to A, chromosome 11 at 98,908,831 bp
  • A to G, chromosome 12 at 4,868,992 bp
  • C to T, chromosome 12 at 110,932,976 bp
  • T to G, chromosome 12 at 111,262,036 bp
  • A to G, chromosome 13 at 13,232,376 bp
  • T to C, chromosome 13 at 81,433,525 bp
  • T to C, chromosome 14 at 31,272,942 bp
  • T to C, chromosome 14 at 41,154,558 bp
  • C to T, chromosome 14 at 51,039,444 bp
  • A to T, chromosome 15 at 47,669,160 bp
  • T to C, chromosome 15 at 91,764,759 bp
  • T to G, chromosome 16 at 4,631,994 bp
  • A to T, chromosome 16 at 32,988,484 bp
  • A to G, chromosome 17 at 3,450,317 bp
  • A to C, chromosome 17 at 5,337,290 bp
  • A to T, chromosome 17 at 19,066,340 bp
  • A to G, chromosome 17 at 29,687,157 bp
  • A to G, chromosome 17 at 36,453,144 bp
  • A to T, chromosome 17 at 42,607,200 bp
  • A to T, chromosome 17 at 71,436,747 bp
  • T to C, chromosome 17 at 88,742,602 bp
  • T to G, chromosome 18 at 62,992,492 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4723 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041959-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.