Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4723Btlr/Mmmh
Stock Number:
041959-MU
Citation ID:
RRID:MMRRC_041959-MU
Other Names:
R4723 (G1), C57BL/6J-MtgxR4723Btlr
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Cmtm7
Name: CKLF-like MARVEL transmembrane domain containing 7
Synonyms: Cklfsf7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102545
VEGA: 9
Homologene: 15882
Cdc6
Name: cell division cycle 6
Synonyms: cell division cycle 18 homolog (S.pombe)-like, CDC18L, CDC18(S.pombe)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23834
HGNC: HGNC:1744
Homologene: 68172
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 84,913,020 bp
  • C to T, chromosome 1 at 87,185,337 bp
  • T to C, chromosome 1 at 93,580,899 bp
  • T to A, chromosome 1 at 151,804,698 bp
  • G to T, chromosome 1 at 172,279,756 bp
  • A to G, chromosome 1 at 181,825,659 bp
  • A to G, chromosome 1 at 185,315,979 bp
  • T to C, chromosome 2 at 25,294,470 bp
  • T to C, chromosome 2 at 52,720,950 bp
  • T to C, chromosome 3 at 33,813,078 bp
  • T to G, chromosome 3 at 92,437,293 bp
  • T to C, chromosome 4 at 43,705,785 bp
  • T to C, chromosome 4 at 45,319,642 bp
  • T to A, chromosome 4 at 59,593,270 bp
  • T to C, chromosome 4 at 63,387,032 bp
  • T to C, chromosome 4 at 94,799,160 bp
  • T to C, chromosome 4 at 112,118,236 bp
  • T to C, chromosome 4 at 117,676,039 bp
  • T to A, chromosome 4 at 118,411,801 bp
  • A to G, chromosome 5 at 34,420,786 bp
  • T to A, chromosome 5 at 73,012,055 bp
  • T to C, chromosome 5 at 120,766,256 bp
  • G to A, chromosome 5 at 139,826,370 bp
  • A to T, chromosome 5 at 140,686,086 bp
  • A to T, chromosome 5 at 144,893,184 bp
  • G to T, chromosome 5 at 148,335,440 bp
  • G to A, chromosome 6 at 30,896,434 bp
  • G to A, chromosome 6 at 83,031,257 bp
  • C to T, chromosome 6 at 87,383,525 bp
  • T to A, chromosome 6 at 115,611,850 bp
  • A to T, chromosome 7 at 44,056,532 bp
  • T to A, chromosome 7 at 45,742,065 bp
  • C to G, chromosome 7 at 101,494,618 bp
  • T to C, chromosome 7 at 104,618,489 bp
  • A to T, chromosome 7 at 108,893,821 bp
  • G to A, chromosome 7 at 118,855,864 bp
  • A to G, chromosome 7 at 120,201,075 bp
  • A to C, chromosome 7 at 140,110,648 bp
  • A to G, chromosome 8 at 13,466,848 bp
  • A to T, chromosome 8 at 13,735,937 bp
  • G to A, chromosome 8 at 19,159,382 bp
  • A to T, chromosome 8 at 22,669,607 bp
  • C to T, chromosome 8 at 104,293,675 bp
  • T to C, chromosome 9 at 20,809,591 bp
  • G to T, chromosome 9 at 21,231,410 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 108,112,655 bp
  • G to A, chromosome 9 at 110,970,160 bp
  • A to C, chromosome 9 at 114,763,391 bp
  • A to G, chromosome 10 at 17,799,267 bp
  • A to G, chromosome 10 at 23,851,691 bp
  • T to C, chromosome 10 at 62,400,354 bp
  • T to A, chromosome 10 at 75,175,329 bp
  • G to A, chromosome 10 at 81,144,440 bp
  • G to A, chromosome 11 at 45,984,765 bp
  • A to G, chromosome 11 at 62,378,612 bp
  • A to G, chromosome 11 at 67,029,993 bp
  • A to G, chromosome 11 at 80,779,841 bp
  • G to A, chromosome 11 at 98,908,831 bp
  • A to G, chromosome 12 at 4,868,992 bp
  • C to T, chromosome 12 at 110,932,976 bp
  • T to G, chromosome 12 at 111,262,036 bp
  • A to G, chromosome 13 at 13,232,376 bp
  • T to C, chromosome 13 at 81,433,525 bp
  • T to C, chromosome 14 at 31,272,942 bp
  • T to C, chromosome 14 at 41,154,558 bp
  • C to T, chromosome 14 at 51,039,444 bp
  • A to T, chromosome 15 at 47,669,160 bp
  • T to C, chromosome 15 at 91,764,759 bp
  • T to G, chromosome 16 at 4,631,994 bp
  • A to T, chromosome 16 at 32,988,484 bp
  • A to G, chromosome 17 at 3,450,317 bp
  • A to C, chromosome 17 at 5,337,290 bp
  • A to T, chromosome 17 at 19,066,340 bp
  • A to G, chromosome 17 at 29,687,157 bp
  • A to G, chromosome 17 at 36,453,144 bp
  • A to T, chromosome 17 at 42,607,200 bp
  • A to T, chromosome 17 at 71,436,747 bp
  • T to C, chromosome 17 at 88,742,602 bp
  • T to G, chromosome 18 at 62,992,492 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4723 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041959-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.