Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4681Btlr/Mmmh
Stock Number:
042015-MU
Citation ID:
RRID:MMRRC_042015-MU
Other Names:
R4681 (G1), C57BL/6J-MtgxR4681Btlr
Major Collection:

Strain Information

Tbcel
Name: tubulin folding cofactor E-like
Synonyms: E130107N23Rik, Lrrc35
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272589
Homologene: 16120
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Clcn7
Name: chloride channel, voltage-sensitive 7
Synonyms: ClC-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26373
HGNC: HGNC:2025
Homologene: 56546
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Gbf1
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107338
HGNC: HGNC:4181
Homologene: 37897
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Bcl6
Name: B cell leukemia/lymphoma 6
Synonyms: Bcl5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12053
HGNC: HGNC:1001
Homologene: 7640
Cdhr1
Name: cadherin-related family member 1
Synonyms: Prcad, Pcdh21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 170677
VEGA: 14
Homologene: 13215
Fabp3
Name: fatty acid binding protein 3, muscle and heart
Synonyms: H-FABP, Fabph-4, Fabph-1, Fabph4, Fabph1, Mdgi, Fabp3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14077
HGNC: HGNC:3557
Homologene: 68379
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Cacna2d3
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12294
Homologene: 74929
Zfp408
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381410
Homologene: 11687
Pcdh20
Name: protocadherin 20
Synonyms: PCDH13, C630015B17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Cab39l
Name: calcium binding protein 39-like
Synonyms: 2810425O13Rik, 1500031K13Rik, MO2L, 4930520C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69008
VEGA: 14
Homologene: 69422
Tbc1d19
Name: TBC1 domain family, member 19
Synonyms: 2810453K03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67249
Homologene: 10130
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Ramp1
Name: receptor (calcitonin) activity modifying protein 1
Synonyms: 9130218E19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51801
HGNC: HGNC:9843
Homologene: 4275
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Liph
Name: lipase, member H
Synonyms: PLA1B, mPA-PLA1, C130037N08Rik, Lpdlr, D16Wsu119e, LPDLR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
Glp2r
Name: glucagon-like peptide 2 receptor
Synonyms: GLP-2, 9530092J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93896
HGNC: HGNC:4325
Homologene: 3132
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Stk31
Name: serine threonine kinase 31
Synonyms: C330007K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77485
Homologene: 12677
Dbt
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: BCKAD E2, D3Wsu60e, dihydrolipoyl transacylase, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13171
HGNC: HGNC:2698
Homologene: 1444
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211223
Homologene: 129606
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Nsun7
Name: NOL1/NOP2/Sun domain family, member 7
Synonyms: 4921525L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70918
Homologene: 11653
Trpm8
Name: transient receptor potential cation channel, subfamily M, member 8
Synonyms: CMR1, TRPP8, Trp-p8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171382
Homologene: 23433
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Ttc19
Name: tetratricopeptide repeat domain 19
Synonyms: 2810460C24Rik, 2010204O13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72795
Homologene: 9831
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Cimap3
Name: ciliary microtubule associated protein 3
Synonyms: pitchfork, 1700027A23Rik, Pifo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100503311
Homologene: 18759
Cgrrf1
Name: cell growth regulator with ring finger domain 1
Synonyms: 1110038G02Rik, CGR19, 1810009H17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68755
Homologene: 4789
Unc5c
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22253
Homologene: 2765
Car2
Name: carbonic anhydrase 2
Synonyms: CAII, CA II, Ltw-5, Car-2, Lvtw-5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12349
HGNC: HGNC:1373
Homologene: 37256
Traf3ip2
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103213
HGNC: HGNC:1343
Homologene: 15885
Gpr45
Name: G protein-coupled receptor 45
Synonyms: PSP24alpha, 9230112G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93690
HGNC: HGNC:4503
Homologene: 5228
Hectd2
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226098
Homologene: 6280
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Cox10
Name: heme A:farnesyltransferase cytochrome c oxidase assembly factor 10
Synonyms: 2410004F01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70383
HGNC: HGNC:2260
Homologene: 80170
Atp4b
Name: ATPase, H+/K+ exchanging, beta polypeptide
Synonyms: H+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11945
HGNC: HGNC:820
Homologene: 20182
Btnl4
Name: butyrophilin-like 4
Synonyms: NG11, EG632126, Btn3a3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 632126
Homologene: 106849
Cfhr1
Name: complement factor H-related 1
Synonyms: Cfhl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50702
Homologene: 55632
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, MOR214-2, Olfr1436
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Or6c75
Name: olfactory receptor family 6 subfamily C member 75
Synonyms: GA_x6K02T2PULF-11179777-11180721, MOR112-1, Olfr790
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258935
Homologene: 74101
S100a8
Name: S100 calcium binding protein A8 (calgranulin A)
Synonyms: MRP8, Caga, 60B8Ag, CFAg, CP-10, B8Ag, p8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20201
Homologene: 2225
C4a
Name: complement C4A (Rodgers blood group)
Synonyms: Slp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 625018
Homologene: 36030
F730035P03Rik
Name: RIKEN cDNA F730035P03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Gm18025
Name: predicted gene, 18025
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100416307
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,032,908 bp
  • A to T, chromosome 1 at 88,384,705 bp
  • T to C, chromosome 1 at 91,196,789 bp
  • A to T, chromosome 1 at 139,550,929 bp
  • G to T, chromosome 1 at 179,752,796 bp
  • G to A, chromosome 2 at 91,645,786 bp
  • T to A, chromosome 3 at 14,895,564 bp
  • T to C, chromosome 3 at 38,887,342 bp
  • T to A, chromosome 3 at 90,669,583 bp
  • A to G, chromosome 3 at 100,951,109 bp
  • C to A, chromosome 3 at 105,998,385 bp
  • A to G, chromosome 3 at 116,533,314 bp
  • T to G, chromosome 3 at 141,768,613 bp
  • C to T, chromosome 4 at 130,312,387 bp
  • CTTCCAGAGCCATGGACCCATCTTTTCCA to CTTCCA, chromosome 4 at 134,072,718 bp
  • G to A, chromosome 5 at 53,872,253 bp
  • T to A, chromosome 5 at 66,261,199 bp
  • T to A, chromosome 5 at 109,286,622 bp
  • A to T, chromosome 5 at 121,303,615 bp
  • C to G, chromosome 5 at 150,552,398 bp
  • A to G, chromosome 6 at 49,437,435 bp
  • G to A, chromosome 6 at 83,981,737 bp
  • T to C, chromosome 7 at 99,780,218 bp
  • T to C, chromosome 8 at 13,389,700 bp
  • T to C, chromosome 8 at 110,506,471 bp
  • G to T, chromosome 8 at 121,608,600 bp
  • G to T, chromosome 9 at 42,449,972 bp
  • A to G, chromosome 9 at 108,827,754 bp
  • C to T, chromosome 10 at 39,639,260 bp
  • A to C, chromosome 10 at 41,427,238 bp
  • A to G, chromosome 10 at 129,501,564 bp
  • T to A, chromosome 11 at 62,309,091 bp
  • T to G, chromosome 11 at 63,976,451 bp
  • C to T, chromosome 11 at 67,730,627 bp
  • T to C, chromosome 12 at 30,012,326 bp
  • A to G, chromosome 12 at 34,290,885 bp
  • A to T, chromosome 12 at 75,007,623 bp
  • A to T, chromosome 14 at 29,293,135 bp
  • T to C, chromosome 14 at 37,096,237 bp
  • A to G, chromosome 14 at 46,853,826 bp
  • A to G, chromosome 14 at 59,499,605 bp
  • A to T, chromosome 14 at 88,467,616 bp
  • T to C, chromosome 15 at 99,280,890 bp
  • A to C, chromosome 16 at 21,984,027 bp
  • A to G, chromosome 16 at 23,968,453 bp
  • A to T, chromosome 16 at 90,804,537 bp
  • A to T, chromosome 17 at 25,157,961 bp
  • A to T, chromosome 17 at 34,470,101 bp
  • G to T, chromosome 17 at 34,817,099 bp
  • A to T, chromosome 17 at 55,654,831 bp
  • T to C, chromosome 17 at 66,449,144 bp
  • T to C, chromosome 19 at 12,299,049 bp
  • T to C, chromosome 19 at 36,604,255 bp
  • A to T, chromosome 19 at 46,280,550 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4681 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042015-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.