Strain Name:
Stock Number:
Citation ID:
Other Names:
R4681 (G1), C57BL/6J-MtgxR4681Btlr
Major Collection:

Strain Information

Name: tubulin folding cofactor E-like
Synonyms: E130107N23Rik, Lrrc35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 272589
Homologene: 16120
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18139
Homologene: 7447
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68617
Homologene: 41017
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226747
Homologene: 9142
Name: chloride channel, voltage-sensitive 7
Synonyms: ClC-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26373
Homologene: 56546
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 207932
Homologene: 45941
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107338
Homologene: 37897
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Name: B cell leukemia/lymphoma 6
Synonyms: Bcl5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12053
Homologene: 7640
Name: cadherin-related family member 1
Synonyms: Prcad, Pcdh21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 170677
VEGA: 14
Homologene: 13215
Name: fatty acid binding protein 3, muscle and heart
Synonyms: H-FABP, Fabph-4, Fabph-1, Fabph4, Fabph1, Mdgi, Fabp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14077
Homologene: 68379
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238271
VEGA: 12
Homologene: 15858
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12294
Homologene: 74929
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381410
Homologene: 11687
Name: protocadherin 20
Synonyms: PCDH13, C630015B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219257
Homologene: 11277
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12190
Homologene: 41
Name: calcium binding protein 39-like
Synonyms: 2810425O13Rik, 1500031K13Rik, MO2L, 4930520C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 69008
VEGA: 14
Homologene: 69422
Name: TBC1 domain family, member 19
Synonyms: 2810453K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67249
Homologene: 10130
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74044
Homologene: 37826
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269700
Homologene: 28297
Name: receptor (calcitonin) activity modifying protein 1
Synonyms: 9130218E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 51801
Homologene: 4275
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 142682
Homologene: 9037
Name: lipase, member H
Synonyms: PLA1B, mPA-PLA1, C130037N08Rik, Lpdlr, D16Wsu119e, LPDLR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
Name: glucagon-like peptide 2 receptor
Synonyms: GLP-2, 9530092J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 93896
Homologene: 3132
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329628
Homologene: 14377
Name: serine threonine kinase 31
Synonyms: C330007K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 77485
Homologene: 12677
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: BCKAD E2, D3Wsu60e, dihydrolipoyl transacylase, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13171
Homologene: 1444
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 211223
Homologene: 129606
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 633979
Homologene: 67934
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 69675
Homologene: 33907
Name: NOL1/NOP2/Sun domain family, member 7
Synonyms: 4921525L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70918
Homologene: 11653
Name: transient receptor potential cation channel, subfamily M, member 8
Synonyms: CMR1, TRPP8, Trp-p8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 171382
Homologene: 23433
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230806
Homologene: 19232
Name: tetratricopeptide repeat domain 19
Synonyms: 2810460C24Rik, 2010204O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72795
Homologene: 9831
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107934
Homologene: 1077
Name: primary cilia formation
Synonyms: pitchfork, 1700027A23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100503311
Homologene: 18759
Name: cell growth regulator with ring finger domain 1
Synonyms: 1110038G02Rik, CGR19, 1810009H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68755
Homologene: 4789
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22253
Homologene: 2765
Name: carbonic anhydrase 2
Synonyms: CAII, CA II, Ltw-5, Car-2, Lvtw-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12349
Homologene: 37256
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103213
Homologene: 15885
Name: G protein-coupled receptor 45
Synonyms: PSP24alpha, 9230112G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93690
Homologene: 5228
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226098
Homologene: 6280
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Name: heme A:farnesyltransferase cytochrome c oxidase assembly factor 10
Synonyms: 2410004F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70383
Homologene: 80170
Name: ATPase, H+/K+ exchanging, beta polypeptide
Synonyms: H+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11945
Homologene: 20182
Name: butyrophilin-like 4
Synonyms: NG11, EG632126, Btn3a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 632126
Homologene: 106849
Name: complement factor H-related 1
Synonyms: Cfhl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 50702
Homologene: 55632
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, MOR214-2, Olfr1436
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258682
Homologene: 83129
Name: olfactory receptor family 6 subfamily C member 75
Synonyms: GA_x6K02T2PULF-11179777-11180721, MOR112-1, Olfr790
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258935
Homologene: 74101
Name: S100 calcium binding protein A8 (calgranulin A)
Synonyms: MRP8, Caga, 60B8Ag, CFAg, CP-10, B8Ag, p8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20201
Homologene: 2225
Name: complement component 4A (Rodgers blood group)
Synonyms: Slp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 625018
Homologene: 36030
Name: RIKEN cDNA F730035P03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Name: predicted gene, 18025
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100416307
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,032,908 bp
  • A to T, chromosome 1 at 88,384,705 bp
  • T to C, chromosome 1 at 91,196,789 bp
  • A to T, chromosome 1 at 139,550,929 bp
  • G to T, chromosome 1 at 179,752,796 bp
  • G to A, chromosome 2 at 91,645,786 bp
  • T to A, chromosome 3 at 14,895,564 bp
  • T to C, chromosome 3 at 38,887,342 bp
  • T to A, chromosome 3 at 90,669,583 bp
  • A to G, chromosome 3 at 100,951,109 bp
  • C to A, chromosome 3 at 105,998,385 bp
  • A to G, chromosome 3 at 116,533,314 bp
  • T to G, chromosome 3 at 141,768,613 bp
  • C to T, chromosome 4 at 130,312,387 bp
  • CTTCCAGAGCCATGGACCCATCTTTTCCA to CTTCCA, chromosome 4 at 134,072,718 bp
  • G to A, chromosome 5 at 53,872,253 bp
  • T to A, chromosome 5 at 66,261,199 bp
  • T to A, chromosome 5 at 109,286,622 bp
  • A to T, chromosome 5 at 121,303,615 bp
  • C to G, chromosome 5 at 150,552,398 bp
  • A to G, chromosome 6 at 49,437,435 bp
  • G to A, chromosome 6 at 83,981,737 bp
  • T to C, chromosome 7 at 99,780,218 bp
  • T to C, chromosome 8 at 13,389,700 bp
  • T to C, chromosome 8 at 110,506,471 bp
  • G to T, chromosome 8 at 121,608,600 bp
  • G to T, chromosome 9 at 42,449,972 bp
  • A to G, chromosome 9 at 108,827,754 bp
  • C to T, chromosome 10 at 39,639,260 bp
  • A to C, chromosome 10 at 41,427,238 bp
  • A to G, chromosome 10 at 129,501,564 bp
  • T to A, chromosome 11 at 62,309,091 bp
  • T to G, chromosome 11 at 63,976,451 bp
  • C to T, chromosome 11 at 67,730,627 bp
  • T to C, chromosome 12 at 30,012,326 bp
  • A to G, chromosome 12 at 34,290,885 bp
  • A to T, chromosome 12 at 75,007,623 bp
  • A to T, chromosome 14 at 29,293,135 bp
  • T to C, chromosome 14 at 37,096,237 bp
  • A to G, chromosome 14 at 46,853,826 bp
  • A to G, chromosome 14 at 59,499,605 bp
  • A to T, chromosome 14 at 88,467,616 bp
  • T to C, chromosome 15 at 99,280,890 bp
  • A to C, chromosome 16 at 21,984,027 bp
  • A to G, chromosome 16 at 23,968,453 bp
  • A to T, chromosome 16 at 90,804,537 bp
  • A to T, chromosome 17 at 25,157,961 bp
  • A to T, chromosome 17 at 34,470,101 bp
  • G to T, chromosome 17 at 34,817,099 bp
  • A to T, chromosome 17 at 55,654,831 bp
  • T to C, chromosome 17 at 66,449,144 bp
  • T to C, chromosome 19 at 12,299,049 bp
  • T to C, chromosome 19 at 36,604,255 bp
  • A to T, chromosome 19 at 46,280,550 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4681 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042015-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.