Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4741Btlr/Mmmh
Stock Number:
042026-MU
Citation ID:
RRID:MMRRC_042026-MU
Other Names:
R4741 (G1), C57BL/6J-MtgxR4741Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Jam2
Name: junction adhesion molecule 2
Synonyms: 2410030G21Rik, JAM-2, VE-JAM, 2410167M24Rik, Jcam2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67374
Homologene: 10929
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Zfand5
Name: zinc finger, AN1-type domain 5
Synonyms: 2310057A04Rik, Zfp216, 5830475F03Rik, Za20d2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22682
Homologene: 21215
Arhgef12
Name: Rho guanine nucleotide exchange factor 12
Synonyms: LARG, 2310014B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69632
VEGA: 9
Homologene: 9088
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
F2rl1
Name: F2R like trypsin receptor 1
Synonyms: PAR-2, Par2, Protease-activated receptor-2, Gpcr11, proteinase-activated receptor-2, coagulation factor II (thrombin) receptor-like 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14063
VEGA: 13
HGNC: HGNC:3538
Homologene: 21087
Slc8a2
Name: solute carrier family 8 (sodium/calcium exchanger), member 2
Synonyms: Ncx2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110891
Homologene: 27358
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70354
Homologene: 18923
Ptcd3
Name: pentatricopeptide repeat domain 3
Synonyms: 2610034F17Rik, 2810422B04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69956
Homologene: 41211
Armc10
Name: armadillo repeat containing 10
Synonyms: 2810037C14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67211
Homologene: 12097
Epm2aip1
Name: EPM2A interacting protein 1
Synonyms: A930003G21Rik, EPM2A (laforin) interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77781
Homologene: 8875
Taf1c
Name: TATA-box binding protein associated factor, RNA polymerase I, C
Synonyms: mTAFI95
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21341
Homologene: 21163
Angptl2
Name: angiopoietin-like 2
Synonyms: Arp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26360
HGNC: HGNC:490
Homologene: 22695
Copb2
Name: COPI coat complex subunit beta 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50797
HGNC: HGNC:2232
Homologene: 3499
Ints7
Name: integrator complex subunit 7
Synonyms: 5930412E23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77065
Homologene: 9136
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: gp160, vp165, IRAP, 4732490P18Rik, 2010309L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Zfp808
Name: zinc finger protein 808
Synonyms: Gm7036
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 630579
Homologene: 134631
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Krt74
Name: keratin 74
Synonyms: Kb37
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406222
VEGA: 15
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, RALGEF2, 5830418G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Rnf225
Name: ring finger protein 225
Synonyms: 2310014L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381845
Homologene: 78604
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: NR2A, NMDAR2A, GluRepsilon1, GluN2A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14811
HGNC: HGNC:4585
Homologene: 645
Vmn2r63
Name: vomeronasal 2, receptor 63
Synonyms: EG435975
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435975
Homologene: 104832
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Tmpo
Name: thymopoietin
Synonyms: TP, 5630400D24Rik, LAP2, lamina-associated polypeptide 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21917
VEGA: 10
Homologene: 31144
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244091
Homologene: 18252
Gm5581
Name: predicted gene 5581
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108169183
Serpinb3b
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B
Synonyms: Scca2-rs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383548
Homologene: 131278
Zdhhc1
Name: zinc finger, DHHC domain containing 1
Synonyms: 4432412D04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70796
Homologene: 36891
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
H2-Ob
Name: histocompatibility 2, O region beta locus
Synonyms: Ob, H-2I, H2-IAb2, H2-Ab, H-2Ob, H2-Ab2, A-beta2, A-beta-2, vic1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15002
HGNC: HGNC:4937
Homologene: 1602
Vmn1r17
Name: vomeronasal 1 receptor 17
Synonyms: V1rc16
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171189
Homologene: 115643
Dtx2
Name: deltex 2, E3 ubiquitin ligase
Synonyms: 2610524D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74198
Homologene: 56904
Best3
Name: bestrophin 3
Synonyms: mBest4, Vmd2l3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382427
VEGA: 10
Homologene: 33850
Papss1
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Synonyms: SK1, Asapk
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23971
HGNC: HGNC:8603
Homologene: 81740
Npy6r
Name: neuropeptide Y receptor Y6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18169
VEGA: 18
HGNC: HGNC:7959
Homologene: 134692
Hddc3
Name: HD domain containing 3
Synonyms: 1110033O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68695
Homologene: 12279
Zfp786
Name: zinc finger protein 786
Synonyms: A730012O14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330301
Homologene: 51849
Hp
Name: haptoglobin
Synonyms: HP-1, preHP2, zonulin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15439
Homologene: 121756
Pcdhgb2
Name: protocadherin gamma subfamily B, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93700
HGNC: HGNC:8709
Homologene: 49571
Ighg1
Name: immunoglobulin heavy constant gamma 1 (G1m marker)
Synonyms: IgG1, Igh-4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16017
3632454L22Rik
Name: RIKEN cDNA 3632454L22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 320606
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 107,154,470 bp
  • A to G, chromosome 1 at 191,619,635 bp
  • T to C, chromosome 2 at 33,246,188 bp
  • T to C, chromosome 2 at 33,336,587 bp
  • T to G, chromosome 2 at 91,511,567 bp
  • T to A, chromosome 2 at 112,803,268 bp
  • C to T, chromosome 2 at 125,740,737 bp
  • A to G, chromosome 3 at 36,942,375 bp
  • T to C, chromosome 3 at 131,619,099 bp
  • A to T, chromosome 4 at 90,224,940 bp
  • A to C, chromosome 4 at 144,195,145 bp
  • T to G, chromosome 5 at 21,651,836 bp
  • T to C, chromosome 5 at 90,260,192 bp
  • T to A, chromosome 5 at 134,516,269 bp
  • C to T, chromosome 5 at 136,026,517 bp
  • G to A, chromosome 6 at 47,820,691 bp
  • A to T, chromosome 6 at 57,361,352 bp
  • T to A, chromosome 6 at 71,902,949 bp
  • A to G, chromosome 6 at 118,613,310 bp
  • T to A, chromosome 6 at 122,079,613 bp
  • T to G, chromosome 6 at 131,166,667 bp
  • A to T, chromosome 7 at 12,927,930 bp
  • T to A, chromosome 7 at 16,134,308 bp
  • C to T, chromosome 7 at 42,928,120 bp
  • A to G, chromosome 7 at 80,345,716 bp
  • A to G, chromosome 7 at 81,551,895 bp
  • A to C, chromosome 8 at 15,910,447 bp
  • A to T, chromosome 8 at 25,673,366 bp
  • CGGGGG to CGGGGGG, chromosome 8 at 105,483,744 bp
  • A to T, chromosome 8 at 109,575,472 bp
  • A to G, chromosome 8 at 119,603,395 bp
  • A to G, chromosome 9 at 42,972,153 bp
  • T to C, chromosome 9 at 53,453,607 bp
  • A to G, chromosome 9 at 67,386,555 bp
  • T to C, chromosome 9 at 98,563,773 bp
  • A to G, chromosome 9 at 111,272,613 bp
  • A to G, chromosome 10 at 67,224,939 bp
  • A to G, chromosome 10 at 91,162,644 bp
  • A to G, chromosome 10 at 107,779,260 bp
  • A to T, chromosome 10 at 117,023,996 bp
  • T to C, chromosome 12 at 113,326,558 bp
  • T to A, chromosome 13 at 62,171,949 bp
  • G to A, chromosome 13 at 95,514,143 bp
  • C to T, chromosome 15 at 101,761,441 bp
  • T to C, chromosome 16 at 9,663,512 bp
  • G to A, chromosome 16 at 84,812,952 bp
  • G to A, chromosome 16 at 88,562,408 bp
  • T to C, chromosome 17 at 17,571,658 bp
  • T to C, chromosome 17 at 28,817,784 bp
  • T to A, chromosome 17 at 34,242,571 bp
  • T to C, chromosome 17 at 56,205,286 bp
  • T to A, chromosome 18 at 37,443,518 bp
  • T to A, chromosome 18 at 37,691,684 bp
  • A to T, chromosome 18 at 44,275,724 bp
  • C to T, chromosome 19 at 21,276,481 bp
  • ATGGAAGCGGGGGCTCCATCCTTGGAAGCGGGGGCTCCATCC to ATGGAAGCGGGGGCTCCATCC, chromosome X at 135,025,194 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4741 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.