Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5235Btlr/Mmmh
Stock Number:
042807-MU
Citation ID:
RRID:MMRRC_042807-MU
Other Names:
R5235 (G1), C57BL/6J-MtgxR5235Btlr
Major Collection:

Strain Information

Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Atg14
Name: autophagy related 14
Synonyms: D14Ertd114e, D14Ertd436e, Barkor
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504663
VEGA: 14
Homologene: 45423
Dek
Name: DEK proto-oncogene
Synonyms: D13H6S231E, 1810019E15Rik, DEK proto-oncogene (DNA binding)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110052
HGNC: HGNC:2768
Homologene: 2593
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Lca5
Name: Leber congenital amaurosis 5 (human)
Synonyms: 5730406O13Rik, ORF64, 4930431B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75782
Homologene: 32718
Tpm3
Name: tropomyosin 3, gamma
Synonyms: hTMnm, hTM30nm, gamma-TM, skalphaTM.2, Tpm-5, Trop-5, Tpm5, Tm5NM
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59069
Homologene: 81889
Gpx7
Name: glutathione peroxidase 7
Synonyms: GPX6, 3110050F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67305
HGNC: HGNC:4559
Homologene: 128491
Dag1
Name: dystroglycan 1
Synonyms: dystrophin associated glycoprotein 1, DG, D9Wsu13e, alpha-dystroglycan, beta-dystroglycan
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13138
HGNC: HGNC:2666
Homologene: 3234
Tnrc6c
Name: trinucleotide repeat containing 6C
Synonyms: 9930033H14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217351
Homologene: 23137
Fgf7
Name: fibroblast growth factor 7
Synonyms: Kgf, Keratinocyte growth factor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14178
HGNC: HGNC:3685
Homologene: 7316
Liph
Name: lipase, member H
Synonyms: PLA1B, mPA-PLA1, C130037N08Rik, Lpdlr, D16Wsu119e, LPDLR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
C3ar1
Name: complement component 3a receptor 1
Synonyms: anaphylatoxin C3a receptor, C3aR
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12267
HGNC: HGNC:1319
Homologene: 2992
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ugt8a
Name: UDP galactosyltransferase 8A
Synonyms: Cgt, mCerGT, Ugt8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22239
Homologene: 20715
Aox1
Name: aldehyde oxidase 1
Synonyms: retinal oxidase, Aox-2, Aox-1, Aox2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Or5d40
Name: olfactory receptor family 5 subfamily D member 40
Synonyms: GA_x6K02T2Q125-49669483-49670421, MOR174-13, Olfr1168
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258524
Homologene: 128091
Spata16
Name: spermatogenesis associated 16
Synonyms: spermatogenesis-related protein, Nyd-sp12, 4930503K02Rik, 4921511F01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70862
Homologene: 49974
Stat2
Name: signal transducer and activator of transcription 2
Synonyms: 1600010G07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20847
VEGA: 10
Homologene: 3952
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Slc29a4
Name: solute carrier family 29 (nucleoside transporters), member 4
Synonyms: ENT4, mPMAT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243328
Homologene: 71345
Or4ac1-ps1
Name: olfactory receptor family 4 subfamily AC member 1, pseudogene 1
Synonyms: GA_x6K02T2Q125-50027818-50027495, Olfr1187-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404484
VEGA: 2
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Rgpr, Lztr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Dnase2a
Name: deoxyribonuclease II alpha
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13423
HGNC: HGNC:2960
Homologene: 68179
Acot11
Name: acyl-CoA thioesterase 11
Synonyms: BFIT1, 2010309H15Rik, Them1, 1110020M10Rik, Thea
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329910
Homologene: 11977
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Nlrx1
Name: NLR family member X1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270151
VEGA: 9
Homologene: 11623
Atg3
Name: autophagy related 3
Synonyms: PC3-96, APG3, 2610016C12Rik, Apg3l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67841
Homologene: 6836
Arfrp1
Name: ARF related protein 1
Synonyms: 1500006I01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76688
HGNC: HGNC:662
Homologene: 2425
Aga
Name: aspartylglucosaminidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11593
HGNC: HGNC:318
Homologene: 13
Phlda1
Name: pleckstrin homology like domain, family A, member 1
Synonyms: TDAG51, DT1P1B11, Tdag
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21664
HGNC: HGNC:8933
Homologene: 7203
Tdpoz8
Name: TD and POZ domain containing 8
Synonyms: Gm4858
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229571
Homologene: 130121
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Ovol3
Name: ovo like zinc finger 3
Synonyms: LOC381867, movo3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381867
Homologene: 35553
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 58,057,555 bp
  • A to T, chromosome 1 at 157,534,764 bp
  • A to T, chromosome 2 at 65,752,011 bp
  • T to A, chromosome 2 at 88,185,568 bp
  • G to A, chromosome 2 at 88,540,425 bp
  • C to A, chromosome 2 at 126,036,020 bp
  • T to C, chromosome 2 at 181,359,505 bp
  • A to G, chromosome 3 at 26,667,632 bp
  • A to G, chromosome 3 at 90,086,495 bp
  • A to G, chromosome 3 at 93,074,086 bp
  • A to C, chromosome 3 at 125,867,480 bp
  • C to T, chromosome 4 at 106,760,130 bp
  • A to G, chromosome 4 at 108,400,992 bp
  • G to A, chromosome 5 at 96,600,750 bp
  • T to C, chromosome 5 at 101,847,106 bp
  • T to A, chromosome 5 at 115,583,568 bp
  • G to A, chromosome 5 at 134,522,791 bp
  • T to A, chromosome 5 at 142,718,768 bp
  • A to G, chromosome 6 at 122,850,922 bp
  • T to A, chromosome 6 at 124,192,054 bp
  • A to T, chromosome 7 at 30,233,474 bp
  • T to C, chromosome 7 at 121,156,470 bp
  • G to A, chromosome 8 at 23,082,196 bp
  • A to T, chromosome 8 at 24,547,186 bp
  • A to G, chromosome 8 at 53,514,326 bp
  • A to T, chromosome 8 at 84,913,439 bp
  • C to T, chromosome 8 at 125,801,502 bp
  • C to T, chromosome 9 at 44,263,750 bp
  • A to T, chromosome 9 at 83,423,054 bp
  • T to C, chromosome 9 at 108,207,698 bp
  • CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC to CCAGCCCCAACCTCAGCCCCAACC, chromosome 10 at 111,507,391 bp
  • T to C, chromosome 10 at 128,291,032 bp
  • G to T, chromosome 11 at 117,760,729 bp
  • A to T, chromosome 13 at 47,086,479 bp
  • G to A, chromosome 14 at 47,568,199 bp
  • T to C, chromosome 15 at 47,629,278 bp
  • G to T, chromosome 16 at 11,413,246 bp
  • A to C, chromosome 16 at 21,984,035 bp
  • A to G, chromosome 16 at 45,159,157 bp
  • T to C, chromosome 18 at 37,727,435 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5235 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042807-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.