Strain Name:
Stock Number:
Citation ID:
Other Names:
R5432 (G1), C57BL/6J-MtgxR5432Btlr
Major Collection:

Strain Information

Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Name: SECIS binding protein 2
Synonyms: 2810012K13Rik, 2210413N07Rik, SBP2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75420
Homologene: 11415
Name: SIK family kinase 3
Synonyms: 5730525O22Rik, 9030204A07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70661
Homologene: 57023
Name: zinc finger CCCH type containing 13
Synonyms: 3110050K21Rik, C87618, 2600010B19Rik, 4930570G11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Name: A kinase anchor protein 13
Synonyms: PROTO-LB, Ht31, 1700026G02Rik, PROTO-LBC, 5730522G15Rik, AKAP-Lbc, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
Homologene: 4903
Name: succinate dehydrogenase complex, subunit A, flavoprotein (Fp)
Synonyms: SDH2, 2310034D06Rik, FP, SDHF
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66945
Homologene: 3073
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
Homologene: 21371
Name: thrombospondin 1
Synonyms: TSP1, tbsp1, Thbs-1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Name: ankyrin repeat and SOCS box-containing 4
Synonyms: 8430401O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65255
Homologene: 9392
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12294
Homologene: 74929
Name: protein disulfide isomerase associated 4
Synonyms: Erp72, U48620, Cai, ERp72
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12304
Homologene: 21020
Name: RB transcriptional corepressor like 2
Synonyms: p130, retinoblastoma-like 2, Rb2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19651
Homologene: 4098
Name: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Synonyms: CGI-80, 2810407B07Rik, AASD-PPT, LYS2, LYS5, 2010309J24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67618
Homologene: 9130
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
Homologene: 15856
Name: regulatory factor X, 7
Synonyms: 9930116O05Rik, D130086K05Rik, Rfxdc2, 2510005N23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319758
Homologene: 11275
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, E530005C20Rik, 2210407G14Rik, Hapip
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
Homologene: 57160
Name: centrosomal protein 295
Synonyms: 5830418K08Rik, LOC382128
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Name: sterile alpha motif domain containing 4
Synonyms: Smaug, 1700111L17Rik, 1700024G08Rik, sunk, 4933436G17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74480
Homologene: 19167
Name: WD repeat domain 72
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546144
Homologene: 52326
Name: Yip1 interacting factor homolog B (S. cerevisiae)
Synonyms: 9430029K10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77254
Homologene: 60114
Name: NIMA (never in mitosis gene a)-related expressed kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23954
Homologene: 1869
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
Homologene: 18279
Name: GTPase, very large interferon inducible, family member 3
Synonyms: Gm1966
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 434223
Homologene: 32708
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
Homologene: 137234
Name: NYN domain and retroviral integrase containing
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 277154
VEGA: 14
Homologene: 19483
Name: elaC ribonuclease Z 1
Synonyms: 8430417G19Rik, 2610018O07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 114615
Homologene: 10272
Name: cilia and flagella associated protein 69
Synonyms: A330021E22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207686
Homologene: 11718
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
Homologene: 33332
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: Arhgap13, 4930572H05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Name: growth factor receptor bound protein 14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50915
Homologene: 3303
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232585
Homologene: 35456
Name: IKAROS family zinc finger 4
Synonyms: Zfpn1a4, Eos, A630026H08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22781
Homologene: 69103
Name: cathepsin 8
Synonyms: Epcs68, CTS2, Epcs70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56094
VEGA: 13
Homologene: 129897
Name: nuclear receptor binding SET domain protein 3
Synonyms: Whsc1l1, WHISTLE
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: antitrypsin, 2A1, alpha-1 antiproteinasin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238393
Homologene: 115927
Name: zinc finger protein 1004
Synonyms: Gm14139
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100271882
Homologene: 134546
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16897
Homologene: 31220
Name: phospholipase A2, group VI
Synonyms: iPLA2beta, iPLA2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 53357
Homologene: 2635
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Name: four jointed box 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14221
Homologene: 7717
Name: predicted gene 16332
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100417200
Name: phospholipase A2 inhibitor and LY6/PLAUR domain containing
Synonyms: 2310033E01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 641361
Homologene: 53159
Name: PR domain containing 11
Synonyms: 8030443D09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100042784
Homologene: 82511
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: I54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390, Olfr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258923
Homologene: 115482
Name: selenophosphate synthetase 2
Synonyms: Sps2, Ysg3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20768
Homologene: 7550
Name: chaperonin containing TCP1 subunit 8-like 1
Synonyms: Gm443, LOC242891
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242891
Homologene: 40943
Name: olfactory receptor family 2 subfamily M member 12
Synonyms: Olfr164, GA_x54KRFPKG5P-15738260-15737319, MOR279-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258443
Homologene: 51725
Name: src homology 2 domain-containing transforming protein D
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20420
VEGA: 17
Homologene: 7537
Name: predicted gene 5414
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406223
VEGA: 15
Name: phospholipid phosphatase 7 (inactive)
Synonyms: D830019K17Rik, NET39, Ppapdc3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227721
Homologene: 41885
Name: keratin associated protein 10-20
Synonyms: Gm2696
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100040299
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 139,891,588 bp
  • A to G, chromosome 2 at 32,095,920 bp
  • A to T, chromosome 2 at 64,930,162 bp
  • G to T, chromosome 2 at 92,975,813 bp
  • T to C, chromosome 2 at 102,450,519 bp
  • A to T, chromosome 2 at 118,114,683 bp
  • A to G, chromosome 2 at 150,191,981 bp
  • T to A, chromosome 4 at 123,459,336 bp
  • C to A, chromosome 5 at 5,581,192 bp
  • T to C, chromosome 5 at 25,516,307 bp
  • A to C, chromosome 6 at 5,430,912 bp
  • A to G, chromosome 6 at 13,190,592 bp
  • A to G, chromosome 6 at 47,798,466 bp
  • T to C, chromosome 7 at 24,542,467 bp
  • T to C, chromosome 7 at 29,245,968 bp
  • C to A, chromosome 7 at 45,336,861 bp
  • A to G, chromosome 7 at 75,602,830 bp
  • T to A, chromosome 7 at 106,600,107 bp
  • G to A, chromosome 7 at 127,273,805 bp
  • A to C, chromosome 8 at 22,148,732 bp
  • T to A, chromosome 8 at 25,673,475 bp
  • G to T, chromosome 8 at 91,102,283 bp
  • G to A, chromosome 9 at 4,309,349 bp
  • T to C, chromosome 9 at 15,351,695 bp
  • A to G, chromosome 9 at 46,123,241 bp
  • A to T, chromosome 9 at 59,865,670 bp
  • A to G, chromosome 9 at 72,593,302 bp
  • T to G, chromosome 9 at 74,275,946 bp
  • G to T, chromosome 10 at 77,814,871 bp
  • T to A, chromosome 10 at 121,869,823 bp
  • A to G, chromosome 10 at 128,634,178 bp
  • T to C, chromosome 11 at 60,707,623 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • G to A, chromosome 11 at 110,141,554 bp
  • T to C, chromosome 11 at 120,287,988 bp
  • T to C, chromosome 12 at 104,220,318 bp
  • AAGCAGCAGCAGCAGCAGCA to AAGCAGCAGCAGCAGCA, chromosome 13 at 51,673,966 bp
  • A to C, chromosome 13 at 61,251,012 bp
  • G to T, chromosome 13 at 74,326,949 bp
  • A to C, chromosome 14 at 28,943,555 bp
  • A to G, chromosome 14 at 47,074,062 bp
  • A to G, chromosome 14 at 55,864,466 bp
  • A to G, chromosome 14 at 75,331,247 bp
  • A to G, chromosome 15 at 79,302,617 bp
  • T to C, chromosome 15 at 101,624,634 bp
  • A to T, chromosome 16 at 19,286,089 bp
  • A to G, chromosome 16 at 34,053,622 bp
  • T to A, chromosome 16 at 52,142,865 bp
  • A to T, chromosome 17 at 55,976,214 bp
  • G to T, chromosome 18 at 12,572,066 bp
  • T to C, chromosome 18 at 73,742,793 bp
  • A to G, chromosome 19 at 41,584,603 bp
  • A to G, chromosome Y at 1,368,022 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5432 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042997-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.