Strain Name:
C57BL/6J-MtgxR5559Btlr/Mmmh
Stock Number:
043116-MU
Citation ID:
RRID:MMRRC_043116-MU
Other Names:
R5559 (G1), C57BL/6J-MtgxR5559Btlr
Major Collection:

Strain Information

Poli
Name: polymerase (DNA directed), iota
Synonyms: Rad30b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26447
HGNC: HGNC:9182
Homologene: 5209
Sf3b3
Name: splicing factor 3b, subunit 3
Synonyms: D8Ertd633e, 5730409A01Rik, 1810061H24Rik, SAP130, RSE1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101943
Homologene: 6579
Chmp2b
Name: charged multivesicular body protein 2B
Synonyms: 1190006E07Rik, chromatin modifying protein 2B
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68942
VEGA: 16
Homologene: 8534
Sp1
Name: trans-acting transcription factor 1
Synonyms: Sp1-1, 1110003E12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20683
Homologene: 8276
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, 9030205D12Rik, A330063D19Rik, AD013
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, 2610021O03Rik, Apc1, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Dcp2
Name: decapping mRNA 2
Synonyms: 5730537H01Rik, 2410015D23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70640
Homologene: 13968
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: 2900011L11Rik, Abcc5a, Abcc5b, Mrp5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Gchfr
Name: GTP cyclohydrolase I feedback regulator
Synonyms: P35, 2010323F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320415
HGNC: HGNC:4194
Homologene: 3849
Cnp
Name: 2',3'-cyclic nucleotide 3' phosphodiesterase
Synonyms: Cnp-1, CNPase, Cnp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12799
HGNC: HGNC:2158
Homologene: 7672
Eva1c
Name: eva-1 homolog C
Synonyms: 4931408A02Rik, Fam176c, 1700092M14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70967
Homologene: 14383
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: 3230402K17Rik, P130, NOPP140
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70769
VEGA: 19
Unkl
Name: unkempt family like zinc finger
Synonyms: 1300004G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74154
Homologene: 62673
Dhx57
Name: DExH-box helicase 57
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Smarcd1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Synonyms: Baf60a, D15Kz1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83797
VEGA: 15
Homologene: 20670
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Serpinb9h
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9h
Synonyms: Gm11397
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544923
HGNC: HGNC:8955
Homologene: 69093
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Dmwd
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: 59, DMR-N9, Dm9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13401
HGNC: HGNC:2936
Homologene: 22559
Unc5c
Name: unc-5 netrin receptor C
Synonyms: B130051O18Rik, Unc5h3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22253
Homologene: 2765
Slc6a21
Name: solute carrier family 6 member 21
Synonyms: 1700039E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76713
Homologene: 66347
Tas2r104
Name: taste receptor, type 2, member 104
Synonyms: Tas2r4, mGR04, T2R04, mt2r45
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387340
Homologene: 130072
Obox5
Name: oocyte specific homeobox 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252829
Homologene: 44937
Vmn1r233
Name: vomeronasal 1 receptor 233
Synonyms: V1rf5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171236
Homologene: 128343
Rwdd2a
Name: RWD domain containing 2A
Synonyms: 1700030C20Rik, Rwdd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69519
Homologene: 12315
P2rx2
Name: purinergic receptor P2X, ligand-gated ion channel, 2
Synonyms: P2X2a, P2x2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231602
Homologene: 14251
Lrrc45
Name: leucine rich repeat containing 45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217366
Homologene: 17019
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Ttc29
Name: tetratricopeptide repeat domain 29
Synonyms: 1700031F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73301
Homologene: 12918
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Tmem69
Name: transmembrane protein 69
Synonyms: A630048M13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230657
Homologene: 9531
Vmn2r51
Name: vomeronasal 2, receptor 51
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042921
Homologene: 113703
Brox
Name: BRO1 domain and CAAX motif containing
Synonyms: 0610010K06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71678
Homologene: 13499
Gm4204
Name: predicted gene 4204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100043064
C4a
Name: complement C4A (Rodgers blood group)
Synonyms: Slp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 625018
Homologene: 36030
Or51f1
Name: olfactory receptor family 51 subfamily F member 1
Synonyms: Olfr566, MOR14-7P, GA_x6K02T2PBJ9-5560696-5559746
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258168
Homologene: 133721
Vmn1r57
Name: vomeronasal 1 receptor 57
Synonyms: Gm7519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665150
Homologene: 41799
Flvcr2
Name: feline leukemia virus subgroup C cellular receptor 2
Synonyms: CCT, Mfsd7c
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217721
VEGA: 12
Homologene: 9840
Anapc15
Name: anaphase promoting complex C subunit 15
Synonyms: 3200002M19Rik, 6330414C15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75430
Homologene: 87047
Ear-ps2
Name: eosinophil-associated, ribonuclease A family, pseudogene 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 93743
RP23-191E1.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Ighv5-9-1
Name: immunoglobulin heavy variable 5-9-1
Synonyms: Gm16886
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 641178
AC125199.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 44,058,515 bp
  • T to C, chromosome 1 at 135,233,195 bp
  • A to T, chromosome 1 at 183,291,988 bp
  • C to T, chromosome 2 at 119,169,706 bp
  • A to T, chromosome 2 at 128,680,434 bp
  • T to A, chromosome 2 at 181,230,126 bp
  • A to G, chromosome 3 at 106,299,001 bp
  • G to T, chromosome 3 at 141,803,787 bp
  • C to G, chromosome 4 at 116,553,191 bp
  • T to C, chromosome 5 at 110,340,561 bp
  • T to C, chromosome 6 at 88,473,096 bp
  • T to A, chromosome 6 at 131,685,131 bp
  • A to G, chromosome 7 at 4,758,450 bp
  • A to G, chromosome 7 at 5,220,899 bp
  • T to C, chromosome 7 at 10,037,326 bp
  • T to A, chromosome 7 at 10,092,201 bp
  • A to T, chromosome 7 at 15,757,597 bp
  • G to A, chromosome 7 at 19,080,438 bp
  • C to A, chromosome 7 at 45,288,429 bp
  • C to T, chromosome 7 at 101,898,905 bp
  • C to T, chromosome 7 at 102,857,207 bp
  • T to A, chromosome 8 at 78,251,695 bp
  • G to A, chromosome 8 at 91,015,925 bp
  • A to T, chromosome 8 at 110,838,215 bp
  • T to C, chromosome 9 at 78,660,968 bp
  • T to C, chromosome 9 at 86,574,430 bp
  • C to A, chromosome 9 at 101,034,714 bp
  • G to T, chromosome 11 at 100,576,417 bp
  • A to T, chromosome 11 at 120,719,105 bp
  • T to A, chromosome 12 at 85,804,407 bp
  • A to T, chromosome 12 at 113,736,125 bp
  • T to A, chromosome 13 at 33,404,318 bp
  • G to A, chromosome 14 at 44,047,060 bp
  • T to G, chromosome 15 at 99,703,295 bp
  • T to A, chromosome 15 at 102,408,930 bp
  • A to T, chromosome 16 at 20,338,886 bp
  • A to T, chromosome 16 at 65,540,430 bp
  • G to T, chromosome 16 at 88,759,093 bp
  • A to G, chromosome 16 at 90,904,251 bp
  • T to C, chromosome 17 at 20,994,577 bp
  • A to G, chromosome 17 at 25,205,713 bp
  • A to G, chromosome 17 at 34,809,539 bp
  • A to T, chromosome 17 at 80,254,379 bp
  • C to A, chromosome 18 at 44,405,487 bp
  • A to G, chromosome 18 at 70,509,285 bp
  • A to C, chromosome 19 at 29,716,963 bp
  • GAGCAGCAGCAGCAGCAGCAGCAGCAGC to GAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,083,155 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5559 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043116-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.