Strain Name:
Stock Number:
Citation ID:
Other Names:
R5744 (G1), C57BL/6J-MtgxR5744Btlr
Major Collection:

Strain Information

Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
Homologene: 23662
Name: single-pass membrane protein with coiled-coil domains 3
Synonyms: C030030A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 654818
Homologene: 79087
Name: transcription factor AP-2 beta
Synonyms: AP-2(beta), E130018K07Rik, Tcfap2b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21419
Homologene: 20688
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
Homologene: 56426
Name: transportin 2 (importin 3, karyopherin beta 2b)
Synonyms: Kpnb2b, TRN2, 1110034O24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212999
Homologene: 8381
Name: sel-1 suppressor of lin-12-like (C. elegans)
Synonyms: Sel1h
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20338
Homologene: 31286
Name: nucleoporin 214
Synonyms: D2H9S46E, CAN
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227720
Homologene: 38008
Name: NSE4 homolog A, SMC5-SMC6 complex component
Synonyms: 2410003A14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67872
Homologene: 9745
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
Homologene: 31207
Name: translocase of outer mitochondrial membrane 70A
Synonyms: D16Ium22, D16Ium22e, 2610044B22Rik, Tomm70a, D16Wsu109e, Tom70
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 28185
VEGA: 16
Homologene: 40112
Name: nucleolar protein 8
Synonyms: 4921532D18Rik, D13Ertd548e, 5730412B09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Name: zinc finger and BTB domain containing 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229055
Homologene: 11395
Name: gem nuclear organelle associated protein 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216766
Homologene: 9155
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276919
Homologene: 69193
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 5
Synonyms: TA1, D0H16S474E, LAT1, Gm42049
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20539
Homologene: 55759
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
Homologene: 3699
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
Homologene: 37593
Name: meteorin, glial cell differentiation regulator
Synonyms: 1810034B16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70083
VEGA: 17
Homologene: 11432
Name: eukaryotic translation initiation factor 3, subunit F
Synonyms: 0610037M02Rik, Eif3s5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66085
Homologene: 2783
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
Name: aldolase 1 A, retrogene 2
Synonyms: Aldo1-ps1, 4933425L11Rik, Aldoa-ps1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 79459
Homologene: 134148
Name: tweety family member 2
Synonyms: 1110001A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 117160
Homologene: 41882
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70729
Homologene: 135990
Name: nei endonuclease VIII-like 1 (E. coli)
Synonyms: 2810450N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72774
Homologene: 11616
Name: chondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms: 4632415D10Rik, Galnact2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78752
Homologene: 23109
Name: heparan sulfate 6-O-sulfotransferase 3
Synonyms: 6OST3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50787
VEGA: 14
Homologene: 89201
Name: interleukin 1 receptor accessory protein
Synonyms: IL-1R AcP, IL-1RAcP, 6430709H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16180
Homologene: 1643
Name: EvC ciliary complex subunit 1
Synonyms: Ellis van Creveld gene syndrome
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59056
Homologene: 10949
Name: olfactory receptor family 7 subfamily A member 37
Synonyms: GA_x6K02T2QGN0-2842591-2841662, MOR139-2, Olfr1353
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259044
Homologene: 131345
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
Homologene: 38286
Name: olfactory receptor family 2 subfamily L member 5
Synonyms: GA_x54KRFPKG5P-15963726-15962788, MOR272-1, Olfr167
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258937
Homologene: 78689
Name: malignant fibrous histiocytoma amplified sequence 1
Synonyms: 2310066G09Rik, D8Ertd91e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52065
Homologene: 3114
Name: sulfotransferase family, cytosolic, 1C, member 1
Synonyms: (PST)G, mOLFST, P-SULT, Stp2, Sult1a2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20888
Homologene: 56817
Name: meningioma 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433938
Homologene: 37620
Name: RIKEN cDNA A530095I07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 210373
Name: trophoblast specific protein alpha
Synonyms: 4311, Tb-1, Tb1, Tpbp, clone 4311
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21984
VEGA: 13
Homologene: 49203
Name: olfactory receptor family 9 subfamily K member 2
Synonyms: GA_x6K02T2PULF-11834065-11833103, MOR210-1, Olfr825
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258672
Homologene: 121503
Name: immunoglobulin superfamily, DCC subclass, member 3
Synonyms: 2810401C09Rik, WI-14920, Punc
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19289
Homologene: 3590
Name: predicted gene 13327
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 19,219,221 bp
  • C to T, chromosome 1 at 170,302,506 bp
  • G to A, chromosome 2 at 21,368,520 bp
  • T to C, chromosome 2 at 32,010,296 bp
  • T to C, chromosome 2 at 155,981,474 bp
  • A to G, chromosome 3 at 9,264,563 bp
  • A to G, chromosome 3 at 53,655,959 bp
  • A to G, chromosome 4 at 154,528,704 bp
  • A to C, chromosome 5 at 22,106,083 bp
  • A to G, chromosome 5 at 37,318,181 bp
  • T to C, chromosome 5 at 111,420,536 bp
  • C to T, chromosome 6 at 89,334,682 bp
  • C to T, chromosome 6 at 118,126,236 bp
  • T to C, chromosome 6 at 136,831,765 bp
  • A to G, chromosome 6 at 146,376,151 bp
  • C to A, chromosome 7 at 108,938,417 bp
  • A to C, chromosome 7 at 130,539,132 bp
  • C to A, chromosome 8 at 35,589,482 bp
  • T to A, chromosome 8 at 85,051,894 bp
  • T to C, chromosome 8 at 121,888,382 bp
  • T to C, chromosome 9 at 57,144,201 bp
  • TGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGC, chromosome 9 at 65,141,488 bp
  • C to T, chromosome 9 at 66,508,193 bp
  • G to T, chromosome 9 at 71,630,675 bp
  • T to C, chromosome 10 at 78,970,183 bp
  • T to C, chromosome 10 at 130,162,792 bp
  • A to G, chromosome 11 at 4,487,679 bp
  • C to A, chromosome 11 at 58,155,183 bp
  • A to T, chromosome 11 at 76,212,165 bp
  • T to C, chromosome 11 at 114,702,310 bp
  • A to G, chromosome 12 at 55,565,346 bp
  • A to T, chromosome 12 at 91,809,980 bp
  • A to T, chromosome 13 at 9,568,405 bp
  • A to G, chromosome 13 at 49,662,326 bp
  • C to T, chromosome 13 at 60,935,953 bp
  • G to T, chromosome 13 at 69,543,722 bp
  • T to C, chromosome 14 at 119,138,440 bp
  • A to G, chromosome 16 at 19,515,336 bp
  • A to C, chromosome 16 at 26,680,224 bp
  • G to T, chromosome 16 at 57,121,839 bp
  • A to G, chromosome 17 at 25,795,237 bp
  • T to A, chromosome 17 at 53,973,962 bp
  • T to C, chromosome 19 at 37,004,490 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043197-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.