Loading Mouse GIF
Loading...

Strain Name:
B6.129S6(FVB)-Apptm1.1Wevn/Mmjax
Stock Number:
043512-JAX
Citation ID:
RRID:MMRRC_043512-JAX
Other Names:
AβPP/KPI R13I, ABPP KPI Knockout

Strain Information

Apptm1.1Wevn
Name: amyloid beta precursor protein; targeted mutation 1.1, William Van Nostrand
Synonyms: AbetaPP/KPIR13I
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Knock-In
App
Name: amyloid beta precursor protein
Synonyms: betaAPP, Abeta, protease nexin II, Adap, Cvap, appican, E030013M08Rik
Type: Gene
Species: Mouse
Chromosome: 16
Alteration at locus: Knock-In
NCBI: 11820
VEGA: 16
HGNC: HGNC:620
Homologene: 56379
Genetic Alterations

The goal was to introduce two point point mutations (CGC to ATC) into murine App (Gene ID11820) predicted to substitute an arginine with a isoleucine at the 13th amino acid position of the Kunitz proteinase inhibitor (KPI) domain (MMRRC Curation Note: this is not p.Arg13Iso of NP_031497.2; the exact genetic variants were not provided). The targeting strategy utilized a 10 kb long-arm fragment with the desired variants.The short arm (1.4 kb) was amplified with primers APPSA2, 5' CCCAGATATCCAGGGAAAGGG 3' and APPSA1,5' CTTCTGACTGCTTCTCTTTACAC 3' and inserted into PspOMI site of Neo gene cassette, flanked by loxP sites.

The targeting vector was linearized by NotI and electroporated into iTL1 embryonic stem cells (origin: 129S6/SvEvTac). The resulting colonies were subsequently treated with G418 for selection. PCR analysis using primers APPSA2, 5' AAGTGGAGTTATCTCCTAGGAGACC 3' (located 100 bp down stream from APPSA2), and Neo 1, 5' TGCGAGGCCAGAGGCCACTTGTGTAGC 3', (located within the 5' promoter region of the Neo gene cassette) resulting in a 1.5 kb PCR fragment, was performed on stably transfected clones to identify successful homologous recombination.The correctly targeted ES cell lines were injected into 3.5 day-old C57BL/6 blastocysts that were transferred into the uteri of pseudopregnant Cd1 foster mothers. Chimeric mice were generated and screened for germ line transmission of the AbetaPP point mutation.For genotyping purposes the wild-type APP allele is identified with primer LOX98AN9, 5' TAGAGGATCCCCGGCCGCTGGACCT 3', and antisense APPKI7, 5' CACCATGATAGCACCTGAGGTGAC 3', resulting in a 300-bp PCR product. Heterozygous offspring, positive for the AbetaPP/KPIR13I point mutation, were crossbred with Jackson E2a-Cre mice (Stock 003724) to remove the Neo gene cassette. Identification of Neo deletion was analyzed by PCR analysis using primers APPKI2, 5' TGTGGCCATGGTGTCTCTTCACAG 3' which is 360-bp downstream of APPSA1 and APPKI1, 5' CAACTCGACTCTAGCCTAGGATGC 3' located upstream of APPSA1 with some vector sequence resulting in a 500-bp PCR product. Homozygous AbetaPP/KPIR13I mutant knock-in mice were identified with a 600-bp PCR product using primer APPKI8, 5' TGCTTCCTCCGTTCAGCCCAGGTC 3', and antisense primer LOX98AN9, 5' GCTAATTCCGATCATATTCAATAACCC 3', and no PCR fragment with LOX98AN9/APPKI7 primers. The AbetaPP/KPIR13I mutant knock in mice were backcrossed for ten generations onto a C57BL/6 background.

Genotype Determination
ES Cell Line
iTL1 derived from 129S6/SvEvTac
Phenotype

Homozygous: These knockout mice do not exhibit any particular homozygote phenotype.

Hetero/Hemizygous: These knockout mice do not exhibit any particular heterozygote phenotype.

Cre-excised Phenotype: Undetermined

Mammalian Phenotype Terms
Allelic Composition: (Genetic Background: )

Strain Development
All mice were bred to have a C57BL/6 background using C57BL/6NTac mice as wildtypes
Suggested Control Mice
Wild-type littermates
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Models for Human Disease
  • Neurobiology
Donor
William Van Nostrand, Ph.D., Stony Brook University.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
MMRRC Breeding System
Sib-mating
Generation
>N10
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 6 to 8 months
Bred to Homozygosity
No
Average litter size
5-9 pups
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043512-JAX-SPERM Cryo-preserved spermatozoa $459.00 / Non-Profit Aliquot Approximate quantity3
043512-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.