Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
The goal was to introduce two point point mutations (CGC to ATC) into murine App (Gene ID11820) predicted to substitute an arginine with a isoleucine at the 13th amino acid position of the Kunitz proteinase inhibitor (KPI) domain (MMRRC Curation Note: this is not p.Arg13Iso of NP_031497.2; the exact genetic variants were not provided). The targeting strategy utilized a 10 kb long-arm fragment with the desired variants.The short arm (1.4 kb) was amplified with primers APPSA2, 5' CCCAGATATCCAGGGAAAGGG 3' and APPSA1,5' CTTCTGACTGCTTCTCTTTACAC 3' and inserted into PspOMI site of Neo gene cassette, flanked by loxP sites.
The targeting vector was linearized by NotI and electroporated into iTL1 embryonic stem cells (origin: 129S6/SvEvTac). The resulting colonies were subsequently treated with G418 for selection. PCR analysis using primers APPSA2, 5' AAGTGGAGTTATCTCCTAGGAGACC 3' (located 100 bp down stream from APPSA2), and Neo 1, 5' TGCGAGGCCAGAGGCCACTTGTGTAGC 3', (located within the 5' promoter region of the Neo gene cassette) resulting in a 1.5 kb PCR fragment, was performed on stably transfected clones to identify successful homologous recombination.The correctly targeted ES cell lines were injected into 3.5 day-old C57BL/6 blastocysts that were transferred into the uteri of pseudopregnant Cd1 foster mothers. Chimeric mice were generated and screened for germ line transmission of the AbetaPP point mutation.For genotyping purposes the wild-type APP allele is identified with primer LOX98AN9, 5' TAGAGGATCCCCGGCCGCTGGACCT 3', and antisense APPKI7, 5' CACCATGATAGCACCTGAGGTGAC 3', resulting in a 300-bp PCR product. Heterozygous offspring, positive for the AbetaPP/KPIR13I point mutation, were crossbred with Jackson E2a-Cre mice (Stock 003724) to remove the Neo gene cassette. Identification of Neo deletion was analyzed by PCR analysis using primers APPKI2, 5' TGTGGCCATGGTGTCTCTTCACAG 3' which is 360-bp downstream of APPSA1 and APPKI1, 5' CAACTCGACTCTAGCCTAGGATGC 3' located upstream of APPSA1 with some vector sequence resulting in a 500-bp PCR product. Homozygous AbetaPP/KPIR13I mutant knock-in mice were identified with a 600-bp PCR product using primer APPKI8, 5' TGCTTCCTCCGTTCAGCCCAGGTC 3', and antisense primer LOX98AN9, 5' GCTAATTCCGATCATATTCAATAACCC 3', and no PCR fragment with LOX98AN9/APPKI7 primers. The AbetaPP/KPIR13I mutant knock in mice were backcrossed for ten generations onto a C57BL/6 background.
Homozygous: These knockout mice do not exhibit any particular homozygote phenotype.
Hetero/Hemizygous: These knockout mice do not exhibit any particular heterozygote phenotype.
Cre-excised Phenotype: Undetermined
To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.
The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.