Strain Name:
C57BL/6J-Hcfc2em1Btlr/Mmmh
Stock Number:
043852-MU
Citation ID:
RRID:MMRRC_043852-MU
Other Names:
Hcfc2^em1Btlr, TALEN-Hcfc2

Strain Information

Hcfc2em1Btlr
Name: host cell factor C2; endonuclease-mediated mutation 1, Bruce Beutler
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Knockout
Hcfc2
Name: host cell factor C2
Synonyms: 1700129L13Rik, fkls
Type: Gene
Species: Mouse
Chromosome: 10
Alteration at locus: Knockout
NCBI: 67933
Homologene: 8337
Genetic Alterations
TALEN targeting was used to generate a knock-out allele, which consisted of a 171-bp deletion that included the ATG start codon.
Genotype Determination
Phenotype

Homozygous: Decreased TNF secretion from macrophages of mice stimulated with polyinosinic:polycytidylic acid ("poly(I:C)").

Hetero/Hemizygous: Not Characterized

Mammalian Phenotype Terms
Allelic Composition: (Genetic Background: )

Strain Development

TALEN approach 

  • tgggaagatggcggctcccagcctcctcaactggaggcgggtttcctcctttaccgga (left)
  • tccgggagctgatgatcatcttcggcgggggcaacgagggcatcgcggacgagctgca (right).

The TALEN constructs recognizing these two targets were built using the TALEN toolbox (from Addgene, deposited by Feng Zhang MIT). TALEN mRNAs were in vitro transcribed using the Invitrogen mMESSAGE mMACHINE kit and used for microinjection. This strain has a 171-bp deletion, which encompasses the ATG start codon. The original mutant was generated on a C57BL/6J background; all subsequent crosses to maintain strain were on C57BL/6J background only.

Suggested Control Mice
Wild-type littermates
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Immunology and Inflammation
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

For more information about this colony's health status contact mmrrc@missouri.edu
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Generation
Unknown
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
No
Average litter size
4-6
Recommended wean age
3-4 weeks
Average Pups Weaned
4-6

Order Request Information

The availability level for this product has not been determined.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.