Strain Name:
C57BL/6J-Hcfc2em1Btlr/Mmmh
Stock Number:
043852-MU
Citation ID:
RRID:MMRRC_043852-MU
Other Names:
Hcfc2^em1Btlr, TALEN-Hcfc2

Gene Information

Allele: Hcfc2em1Btlr (Mus musculus (mouse))
Name: host cell factor C2; endonuclease-mediated mutation 1, Bruce Beutler
Chromosome: 10
Alteration at locus: Knockout
Monarch Initiative (Disease and Phenotype Associations): MGI:6108107
Gene: Hcfc2 (Mus musculus (mouse))
Name: host cell factor C2
Synonyms: 1700129L13Rik, fkls
Chromosome: 10
Alteration at locus: Knockout
Monarch Initiative (Disease and Phenotype Associations): MGI:1915183
Genetic Alterations
TALEN targeting was used to generate a knock-out allele, which consisted of a 171-bp deletion that included the ATG start codon.
ES Cell Line
N/A
Phenotype

Homozygous: Decreased TNF secretion from macrophages of mice stimulated with polyinosinic:polycytidylic acid ("poly(I:C)").

Hetero/Hemizygous: Not Characterized

Mammalian Phenotype Terms
Allelic Composition: (Genetic Background: )

MeSH Terms
    Strain Development

    TALEN approach 

    • tgggaagatggcggctcccagcctcctcaactggaggcgggtttcctcctttaccgga (left)
    • tccgggagctgatgatcatcttcggcgggggcaacgagggcatcgcggacgagctgca (right).

    The TALEN constructs recognizing these two targets were built using the TALEN toolbox (from Addgene, deposited by Feng Zhang MIT). TALEN mRNAs were in vitro transcribed using the Invitrogen mMESSAGE mMACHINE kit and used for microinjection. This strain has a 171-bp deletion, which encompasses the ATG start codon. The original mutant was generated on a C57BL/6J background; all subsequent crosses to maintain strain were on C57BL/6J background only.

    Suggested Control Mice
    Wild-type littermates
    • Immunology and Inflammation
    Donor
    Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

    Colony and Husbandry Informationon

    Colony Surveillance Program and Current Health Reports

    Mice derived from requested cell lines via Microinjection services will be pathogen tested prior to delivery of mice and health reports will be provided. If you require additional health status information prior to requesting microinjection please email mmrrc@missouri.edu.
    Coat Color
    Black
    MMRRC Breeding System
    Random intra-strain mating
    Generation
    Unknown
    Overall Breeding Performance
    Excellent
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: Undetermined Undetermined
    Bred to Homozygosity
    No
    Average litter size
    4-6
    Recommended wean age
    3-4 weeks
    Average Pups Weaned
    4-6

    Order Request Information

    When this strain becomes available, Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    - Products for this strain are Not Yet Available for Ordering
    - If you register interest in this strain, you will be notified when it becomes available for ordering.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.