Strain Name:
C57BL/6J-MtgxR5976Btlr
Stock Number:
044158-MU
Citation ID:
RRID:MMRRC_044158-MU
Other Names:
R5976 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Grin3a
Name: glutamate receptor ionotropic, NMDA3A
Synonyms: NMDAR-L, NR3A, A830097C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242443
Homologene: 128613
Tbcel
Name: tubulin folding cofactor E-like
Synonyms: E130107N23Rik, Lrrc35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 272589
Homologene: 16120
Nbea
Name: neurobeachin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Paip1
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218693
Homologene: 4709
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Map2k4
Name: mitogen-activated protein kinase kinase 4
Synonyms: MKK4, JNKK1, Serk1, Sek1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 26398
HGNC: HGNC:6844
Homologene: 48159
Ptprg
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Bend3
Name: BEN domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 331623
VEGA: 10
Homologene: 19511
Chaf1a
Name: chromatin assembly factor 1, subunit A (p150)
Synonyms: CAF-1, p150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27221
VEGA: 17
HGNC: HGNC:1910
Homologene: 4003
Ipo7
Name: importin 7
Synonyms: RanBP7, Imp7, A330055O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233726
HGNC: HGNC:9852
Homologene: 4659
Dclk2
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70762
Homologene: 69431
Ing3
Name: inhibitor of growth family, member 3
Synonyms: P47ING3, 1300013A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71777
Homologene: 6804
Ccnh
Name: cyclin H
Synonyms: 6330408H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66671
HGNC: HGNC:1594
Homologene: 946
St7
Name: suppression of tumorigenicity 7
Synonyms: RAY1, HELG, SEN4, TSG7, Fam4a2, 9430001H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 64213
Homologene: 10185
Gabbr1
Name: gamma-aminobutyric acid (GABA) B receptor, 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Nr3c1
Name: nuclear receptor subfamily 3, group C, member 1
Synonyms: GR, Grl-1, Grl1, glucocorticoid receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14815
HGNC: HGNC:7978
Homologene: 30960
Tmtc3
Name: transmembrane and tetratricopeptide repeat containing 3
Synonyms: 9130014E20Rik, B130008E12Rik, mSmile
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237500
Homologene: 27616
Arih2
Name: ariadne RBR E3 ubiquitin protein ligase 2
Synonyms: TRIAD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23807
HGNC: HGNC:690
Homologene: 48424
Gprc5c
Name: G protein-coupled receptor, family C, group 5, member C
Synonyms: 1110028I06Rik, 3200002M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70355
Homologene: 11099
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Nsun2
Name: NOL1/NOP2/Sun domain family member 2
Synonyms: Misu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 28114
Homologene: 9817
R3hcc1l
Name: R3H domain and coiled-coil containing 1 like
Synonyms: 1700036B12Rik, D19Ertd386e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52013
Homologene: 8707
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232339
Homologene: 45968
Rbm19
Name: RNA binding motif protein 19
Synonyms: 1200009A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74111
Homologene: 7158
Slc25a38
Name: solute carrier family 25, member 38
Synonyms: appoptosin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208638
Homologene: 5553
Kdm6b
Name: KDM1 lysine (K)-specific demethylase 6B
Synonyms: Jmjd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216850
Homologene: 18945
Cldn4
Name: claudin 4
Synonyms: Cpetr1, Cpetr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12740
HGNC: HGNC:2046
Homologene: 1000
Eif4e1b
Name: eukaryotic translation initiation factor 4E family member 1B
Synonyms: Eif4eloo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218268
Homologene: 100945
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Ptp4a3
Name: protein tyrosine phosphatase 4a3
Synonyms: Prl-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19245
VEGA: 15
HGNC: HGNC:9636
Homologene: 22500
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Pigg
Name: phosphatidylinositol glycan anchor biosynthesis, class G
Synonyms: Gpi7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 433931
Homologene: 39421
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237954
Homologene: 138824
Enpep
Name: glutamyl aminopeptidase
Synonyms: Bp-1/6C3, APA, Ly-51, Ly51, 6030431M22Rik, aminopeptidase-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13809
HGNC: HGNC:3355
Homologene: 68216
Slc1a5
Name: solute carrier family 1 (neutral amino acid transporter), member 5
Synonyms: ASCT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20514
Homologene: 21155
Bltp2
Name: bridge-like lipid transfer protein family member 2
Synonyms: 2610507B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72503
Homologene: 34730
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Or8b37
Name: olfactory receptor family 8 subfamily B member 37
Synonyms: GA_x6K02T2PVTD-31726544-31727473, MOR162-11P, MOR162-9P, MOR162-11P, MOR162-13, Olfr1550-ps1, Olfr884
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 257996
Homologene: 79400
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22371
Homologene: 466
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212392
Homologene: 17668
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319695
Homologene: 85163
Edem1
Name: ER degradation enhancer, mannosidase alpha-like 1
Synonyms: A130059K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 192193
Homologene: 33836
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Otoa
Name: otoancorin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 246190
Homologene: 71803
Pfkfb2
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms: PFK-2/FBPase-2 gene B, 4930568D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18640
HGNC: HGNC:8873
Homologene: 88554
Pde1a
Name: phosphodiesterase 1A, calmodulin-dependent
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18573
HGNC: HGNC:8774
Homologene: 21043
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74362
Homologene: 52601
Elmo3
Name: engulfment and cell motility 3
Synonyms: CED-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234683
Homologene: 23475
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Ranbp3l
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Mfsd2b
Name: major facilitator superfamily domain containing 2B
Synonyms: Gm1964
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432628
Homologene: 47753
Rgma
Name: repulsive guidance molecule family member A
Synonyms: RGM domain family, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244058
Homologene: 10626
Fah
Name: fumarylacetoacetate hydrolase
Synonyms: swst
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14085
HGNC: HGNC:3579
Homologene: 110
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12722
Homologene: 77224
Serpinb9e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9e
Synonyms: Spi14, NK26, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20710
HGNC: HGNC:8955
Homologene: 69093
Hsd17b6
Name: hydroxysteroid (17-beta) dehydrogenase 6
Synonyms: Rdh8, 17betaHSD9, Hsd17b9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 27400
VEGA: 10
Homologene: 20811
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, Ankrd64, 6330439K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241688
Homologene: 10037
Or10ab4
Name: olfactory receptor family 10 subfamily AB member 4
Synonyms: GA_x6K02T2PBJ9-10384085-10385068, MOR267-15, Olfr479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 257891
Homologene: 79346
Exoc8
Name: exocyst complex component 8
Synonyms: Exo84p, SEC84, EXO84
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102058
Homologene: 44545
AW146154
Name: expressed sequence AW146154
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101835
Homologene: 134516
Gm10770
Name: predicted gene 10770
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 544945
VEGA: 2
Rogdi
Name: rogdi homolog
Synonyms: 0610011C19Rik, Lzf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66049
Homologene: 11605
Ighv1-7
Name: immunoglobulin heavy variable V1-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 668474
Aim1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 72,643,291 bp
  • T to A, chromosome 1 at 130,708,079 bp
  • A to G, chromosome 2 at 52,216,916 bp
  • G to A, chromosome 2 at 79,868,242 bp
  • T to C, chromosome 2 at 104,471,184 bp
  • C to A, chromosome 2 at 144,501,489 bp
  • T to A, chromosome 2 at 150,179,400 bp
  • T to C, chromosome 3 at 55,853,847 bp
  • C to A, chromosome 3 at 86,787,225 bp
  • C to T, chromosome 3 at 100,095,791 bp
  • A to G, chromosome 3 at 129,299,124 bp
  • A to T, chromosome 3 at 144,746,875 bp
  • T to A, chromosome 4 at 49,792,602 bp
  • G to A, chromosome 4 at 64,018,166 bp
  • TGGAGGAGGAGGAGGAGGAG to TGGAGGAGGAGGAGGAG, chromosome 4 at 134,074,526 bp
  • T to C, chromosome 5 at 77,268,272 bp
  • A to G, chromosome 5 at 108,332,191 bp
  • T to A, chromosome 5 at 120,140,307 bp
  • A to G, chromosome 5 at 134,946,556 bp
  • C to A, chromosome 6 at 17,694,222 bp
  • T to A, chromosome 6 at 21,971,174 bp
  • T to A, chromosome 6 at 108,842,962 bp
  • A to T, chromosome 6 at 118,517,894 bp
  • A to G, chromosome 6 at 125,603,463 bp
  • A to G, chromosome 7 at 16,076,419 bp
  • T to C, chromosome 7 at 16,795,882 bp
  • T to G, chromosome 7 at 41,480,297 bp
  • T to C, chromosome 7 at 73,409,468 bp
  • A to G, chromosome 7 at 84,594,741 bp
  • T to A, chromosome 7 at 108,055,798 bp
  • T to C, chromosome 7 at 110,048,807 bp
  • T to A, chromosome 7 at 121,127,713 bp
  • A to T, chromosome 8 at 45,943,499 bp
  • A to G, chromosome 8 at 105,307,647 bp
  • A to G, chromosome 8 at 124,896,653 bp
  • G to T, chromosome 9 at 38,047,701 bp
  • T to A, chromosome 9 at 42,439,203 bp
  • A to T, chromosome 9 at 108,607,973 bp
  • A to G, chromosome 9 at 120,116,547 bp
  • C to T, chromosome 10 at 27,190,676 bp
  • A to G, chromosome 10 at 43,510,544 bp
  • A to G, chromosome 10 at 100,476,672 bp
  • A to T, chromosome 10 at 127,583,901 bp
  • T to A, chromosome 10 at 127,991,439 bp
  • T to A, chromosome 11 at 65,709,952 bp
  • A to G, chromosome 11 at 69,403,788 bp
  • G to A, chromosome 11 at 78,284,129 bp
  • A to G, chromosome 11 at 103,499,071 bp
  • A to T, chromosome 11 at 114,864,487 bp
  • G to T, chromosome 12 at 4,866,522 bp
  • T to A, chromosome 12 at 114,538,759 bp
  • T to A, chromosome 13 at 33,255,129 bp
  • T to C, chromosome 13 at 54,784,822 bp
  • T to G, chromosome 13 at 69,623,152 bp
  • C to T, chromosome 13 at 85,190,863 bp
  • T to A, chromosome 13 at 119,456,997 bp
  • A to G, chromosome 14 at 12,211,625 bp
  • T to G, chromosome 15 at 9,002,093 bp
  • T to C, chromosome 15 at 73,756,036 bp
  • T to C, chromosome 15 at 76,189,037 bp
  • C to A, chromosome 15 at 76,709,424 bp
  • T to G, chromosome 15 at 90,935,812 bp
  • T to A, chromosome 16 at 5,013,311 bp
  • T to C, chromosome 17 at 37,067,862 bp
  • T to A, chromosome 17 at 56,064,115 bp
  • T to C, chromosome 17 at 75,290,083 bp
  • A to T, chromosome 18 at 39,421,549 bp
  • T to A, chromosome 19 at 42,563,350 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5976 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044158-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.