Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5976Btlr/Mmmh
Stock Number:
044158-MU
Citation ID:
RRID:MMRRC_044158-MU
Other Names:
R5976 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Grin3a
Name: glutamate receptor ionotropic, NMDA3A
Synonyms: NMDAR-L, NR3A, A830097C19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242443
Homologene: 128613
Tbcel
Name: tubulin folding cofactor E-like
Synonyms: E130107N23Rik, Lrrc35
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272589
Homologene: 16120
Paip1
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218693
Homologene: 4709
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Map2k4
Name: mitogen-activated protein kinase kinase 4
Synonyms: MKK4, JNKK1, Serk1, Sek1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26398
HGNC: HGNC:6844
Homologene: 48159
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 72,643,291 bp
  • T to A, chromosome 1 at 130,708,079 bp
  • A to G, chromosome 2 at 52,216,916 bp
  • G to A, chromosome 2 at 79,868,242 bp
  • T to C, chromosome 2 at 104,471,184 bp
  • C to A, chromosome 2 at 144,501,489 bp
  • T to A, chromosome 2 at 150,179,400 bp
  • T to C, chromosome 3 at 55,853,847 bp
  • C to A, chromosome 3 at 86,787,225 bp
  • C to T, chromosome 3 at 100,095,791 bp
  • A to G, chromosome 3 at 129,299,124 bp
  • A to T, chromosome 3 at 144,746,875 bp
  • T to A, chromosome 4 at 49,792,602 bp
  • G to A, chromosome 4 at 64,018,166 bp
  • TGGAGGAGGAGGAGGAGGAG to TGGAGGAGGAGGAGGAG, chromosome 4 at 134,074,526 bp
  • T to C, chromosome 5 at 77,268,272 bp
  • A to G, chromosome 5 at 108,332,191 bp
  • T to A, chromosome 5 at 120,140,307 bp
  • A to G, chromosome 5 at 134,946,556 bp
  • C to A, chromosome 6 at 17,694,222 bp
  • T to A, chromosome 6 at 21,971,174 bp
  • T to A, chromosome 6 at 108,842,962 bp
  • A to T, chromosome 6 at 118,517,894 bp
  • A to G, chromosome 6 at 125,603,463 bp
  • A to G, chromosome 7 at 16,076,419 bp
  • T to C, chromosome 7 at 16,795,882 bp
  • T to G, chromosome 7 at 41,480,297 bp
  • T to C, chromosome 7 at 73,409,468 bp
  • A to G, chromosome 7 at 84,594,741 bp
  • T to A, chromosome 7 at 108,055,798 bp
  • T to C, chromosome 7 at 110,048,807 bp
  • T to A, chromosome 7 at 121,127,713 bp
  • A to T, chromosome 8 at 45,943,499 bp
  • A to G, chromosome 8 at 105,307,647 bp
  • A to G, chromosome 8 at 124,896,653 bp
  • G to T, chromosome 9 at 38,047,701 bp
  • T to A, chromosome 9 at 42,439,203 bp
  • A to T, chromosome 9 at 108,607,973 bp
  • A to G, chromosome 9 at 120,116,547 bp
  • C to T, chromosome 10 at 27,190,676 bp
  • A to G, chromosome 10 at 43,510,544 bp
  • A to G, chromosome 10 at 100,476,672 bp
  • A to T, chromosome 10 at 127,583,901 bp
  • T to A, chromosome 10 at 127,991,439 bp
  • T to A, chromosome 11 at 65,709,952 bp
  • A to G, chromosome 11 at 69,403,788 bp
  • G to A, chromosome 11 at 78,284,129 bp
  • A to G, chromosome 11 at 103,499,071 bp
  • A to T, chromosome 11 at 114,864,487 bp
  • G to T, chromosome 12 at 4,866,522 bp
  • T to A, chromosome 12 at 114,538,759 bp
  • T to A, chromosome 13 at 33,255,129 bp
  • T to C, chromosome 13 at 54,784,822 bp
  • T to G, chromosome 13 at 69,623,152 bp
  • C to T, chromosome 13 at 85,190,863 bp
  • T to A, chromosome 13 at 119,456,997 bp
  • A to G, chromosome 14 at 12,211,625 bp
  • T to G, chromosome 15 at 9,002,093 bp
  • T to C, chromosome 15 at 73,756,036 bp
  • T to C, chromosome 15 at 76,189,037 bp
  • C to A, chromosome 15 at 76,709,424 bp
  • T to G, chromosome 15 at 90,935,812 bp
  • T to A, chromosome 16 at 5,013,311 bp
  • T to C, chromosome 17 at 37,067,862 bp
  • T to A, chromosome 17 at 56,064,115 bp
  • T to C, chromosome 17 at 75,290,083 bp
  • A to T, chromosome 18 at 39,421,549 bp
  • T to A, chromosome 19 at 42,563,350 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5976 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044158-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.