Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6460Btlr/Mmmh
Stock Number:
044595-MU
Citation ID:
RRID:MMRRC_044595-MU
Other Names:
R6460 (G1)
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Arfgef1
Name: ARF guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Trip4
Name: thyroid hormone receptor interactor 4
Synonyms: ASC-1, 4930558E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56404
Homologene: 9426
Eya3
Name: EYA transcriptional coactivator and phosphatase 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14050
HGNC: HGNC:3521
Homologene: 1508
Spag9
Name: sperm associated antigen 9
Synonyms: 4733401I23Rik, syd1, 4831406C20Rik, Mapk8ip4, JIP4, 3110018C07Rik, JLP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Fchsd1
Name: FCH and double SH3 domains 1
Synonyms: A030002D08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319262
Homologene: 14127
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Hspa9
Name: heat shock protein 9
Synonyms: mortalin, Hsp74a, Hsp74, Hsc74, PBP74, GRP75, mthsp70, mot-2, Hspa9a, C3H-specific antigen, CSA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15526
HGNC: HGNC:5244
Homologene: 39452
Rb1
Name: RB transcriptional corepressor 1
Synonyms: pRb, Rb, Rb-1, retinoblastoma 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19645
HGNC: HGNC:9884
Homologene: 272
Zfp54
Name: zinc finger protein 54
Synonyms: clone 18, KRAB10, Zfp-54, Zfp76
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22712
Homologene: 129791
Trmt10b
Name: tRNA methyltransferase 10B
Synonyms: 2610042J10Rik, Rg9mtd3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69934
Homologene: 12340
Dnajc18
Name: DnaJ heat shock protein family (Hsp40) member C18
Synonyms: 2700075B01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76594
VEGA: 18
Homologene: 23692
Pom121
Name: nuclear pore membrane protein 121
Synonyms: 2610027A18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107939
Homologene: 70878
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: 2810027M23Rik, auxilin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72685
Homologene: 8865
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333050
Homologene: 45469
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Zfp831
Name: zinc finger protein 831
Synonyms: ENSMUSG00000050600, OTTMUSG00000017459
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Stxbp4
Name: syntaxin binding protein 4
Synonyms: Synip, 6030470M02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20913
Homologene: 7963
Srp72
Name: signal recognition particle 72
Synonyms: 72kDa, 5730576P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66661
Homologene: 38254
Sec24c
Name: SEC24 homolog C, COPII coat complex component
Synonyms: 2610204K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218811
VEGA: 14
Homologene: 3615
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Sycp1
Name: synaptonemal complex protein 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20957
Homologene: 2389
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Cabcoco1
Name: ciliary associated calcium binding coiled-coil 1
Synonyms: 1700040L02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73287
Homologene: 12495
Hecw2
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: D030049F17Rik, Nedl2, A730039N16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329152
Homologene: 66192
Tpk1
Name: thiamine pyrophosphokinase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 29807
Homologene: 6960
Shkbp1
Name: Sh3kbp1 binding protein 1
Synonyms: SB1, B930062H15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 192192
Homologene: 26700
Ablim1
Name: actin-binding LIM protein 1
Synonyms: Limab1, abLIM-S, abLIM-M, abLIM-L, 4833406P10Rik, 2610209L21Rik, 9330196J19Rik, 2210411C18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226251
HGNC: HGNC:78
Homologene: 40994
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Nfatc2ip
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
Synonyms: NIP45, D7Ertd304e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18020
Homologene: 7862
Arhgef33
Name: Rho guanine nucleotide exchange factor 33
Synonyms: LOC381112, Gm941
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381112
VEGA: 17
Homologene: 55190
Hhatl
Name: hedgehog acyltransferase-like
Synonyms: 1110011D13Rik, Gup1, Mitsugumin 56, Mg56
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74770
VEGA: 9
Homologene: 19287
Zfp438
Name: zinc finger protein 438
Synonyms: 9430091M14Rik, B830013J05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240186
VEGA: 18
Homologene: 18695
Map2k1
Name: mitogen-activated protein kinase kinase 1
Synonyms: MAP kinase kinase 1, Prkmk1, Mek1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26395
HGNC: HGNC:6840
Homologene: 2063
Coq9
Name: coenzyme Q9
Synonyms: 2310005O14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67914
Homologene: 6477
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Or10d3
Name: olfactory receptor family 10 subfamily D member 3
Synonyms: GA_x6K02T2PVTD-33247839-33246901, MOR224-9, Olfr958
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258327
VEGA: 9
HGNC: HGNC:8168
Homologene: 27128
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Stk32c
Name: serine/threonine kinase 32C
Synonyms: YANK3, Pkek
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57740
Homologene: 75157
Apof
Name: apolipoprotein F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103161
VEGA: 10
HGNC: HGNC:615
Homologene: 48030
Emg1
Name: EMG1 N1-specific pseudouridine methyltransferase
Synonyms: Grcc2f
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14791
Homologene: 4617
Irgq
Name: immunity-related GTPase family, Q
Synonyms: FKSG27
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210146
Homologene: 17696
Trav21-dv12
Name: T cell receptor alpha variable 21-DV12
Synonyms: Gm13892
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100101940
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 10,213,060 bp
  • T to A, chromosome 1 at 53,868,833 bp
  • C to A, chromosome 1 at 82,466,532 bp
  • A to G, chromosome 1 at 166,497,513 bp
  • G to A, chromosome 2 at 76,916,888 bp
  • G to T, chromosome 2 at 174,646,567 bp
  • C to A, chromosome 3 at 68,494,894 bp
  • T to G, chromosome 3 at 102,925,253 bp
  • A to G, chromosome 4 at 45,314,322 bp
  • A to G, chromosome 4 at 101,615,598 bp
  • A to G, chromosome 4 at 132,680,863 bp
  • T to C, chromosome 4 at 149,192,596 bp
  • T to C, chromosome 5 at 14,679,132 bp
  • C to A, chromosome 5 at 76,987,991 bp
  • T to A, chromosome 5 at 117,756,384 bp
  • T to C, chromosome 5 at 135,391,683 bp
  • T to C, chromosome 6 at 43,469,027 bp
  • T to A, chromosome 6 at 58,890,123 bp
  • A to G, chromosome 6 at 124,711,907 bp
  • T to A, chromosome 7 at 24,533,690 bp
  • T to A, chromosome 7 at 27,350,538 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • A to G, chromosome 7 at 126,387,737 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 7 at 126,494,248 bp
  • T to A, chromosome 7 at 139,105,274 bp
  • T to A, chromosome 8 at 31,818,533 bp
  • T to A, chromosome 8 at 94,853,186 bp
  • A to G, chromosome 9 at 15,967,000 bp
  • A to G, chromosome 9 at 18,640,516 bp
  • CAGAG to CAG, chromosome 9 at 39,550,792 bp
  • A to G, chromosome 9 at 64,187,295 bp
  • A to T, chromosome 9 at 65,881,020 bp
  • C to T, chromosome 9 at 121,789,522 bp
  • T to C, chromosome 10 at 23,152,012 bp
  • T to C, chromosome 10 at 68,516,381 bp
  • A to T, chromosome 10 at 80,009,028 bp
  • T to C, chromosome 10 at 103,200,698 bp
  • T to A, chromosome 10 at 128,269,217 bp
  • T to C, chromosome 11 at 67,221,376 bp
  • T to C, chromosome 11 at 73,711,652 bp
  • A to T, chromosome 11 at 90,606,985 bp
  • T to C, chromosome 11 at 94,068,975 bp
  • T to C, chromosome 12 at 112,786,990 bp
  • T to C, chromosome 13 at 40,287,979 bp
  • T to A, chromosome 13 at 89,690,687 bp
  • T to A, chromosome 14 at 20,690,800 bp
  • C to T, chromosome 14 at 53,876,734 bp
  • A to C, chromosome 14 at 73,278,454 bp
  • T to A, chromosome 17 at 21,433,742 bp
  • A to G, chromosome 17 at 80,349,589 bp
  • C to A, chromosome 18 at 5,213,603 bp
  • A to T, chromosome 18 at 34,952,712 bp
  • A to T, chromosome 18 at 35,700,910 bp
  • A to T, chromosome 18 at 37,959,844 bp
  • A to G, chromosome 19 at 57,079,839 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6460 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044595-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.