Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6460Btlr/Mmmh
Stock Number:
044595-MU
Citation ID:
RRID:MMRRC_044595-MU
Other Names:
R6460 (G1)
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Arfgef1
Name: ARF guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 10,213,060 bp
  • T to A, chromosome 1 at 53,868,833 bp
  • C to A, chromosome 1 at 82,466,532 bp
  • A to G, chromosome 1 at 166,497,513 bp
  • G to A, chromosome 2 at 76,916,888 bp
  • G to T, chromosome 2 at 174,646,567 bp
  • C to A, chromosome 3 at 68,494,894 bp
  • T to G, chromosome 3 at 102,925,253 bp
  • A to G, chromosome 4 at 45,314,322 bp
  • A to G, chromosome 4 at 101,615,598 bp
  • A to G, chromosome 4 at 132,680,863 bp
  • T to C, chromosome 4 at 149,192,596 bp
  • T to C, chromosome 5 at 14,679,132 bp
  • C to A, chromosome 5 at 76,987,991 bp
  • T to A, chromosome 5 at 117,756,384 bp
  • T to C, chromosome 5 at 135,391,683 bp
  • T to C, chromosome 6 at 43,469,027 bp
  • T to A, chromosome 6 at 58,890,123 bp
  • A to G, chromosome 6 at 124,711,907 bp
  • T to A, chromosome 7 at 24,533,690 bp
  • T to A, chromosome 7 at 27,350,538 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • A to G, chromosome 7 at 126,387,737 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 7 at 126,494,248 bp
  • T to A, chromosome 7 at 139,105,274 bp
  • T to A, chromosome 8 at 31,818,533 bp
  • T to A, chromosome 8 at 94,853,186 bp
  • A to G, chromosome 9 at 15,967,000 bp
  • A to G, chromosome 9 at 18,640,516 bp
  • CAGAG to CAG, chromosome 9 at 39,550,792 bp
  • A to G, chromosome 9 at 64,187,295 bp
  • A to T, chromosome 9 at 65,881,020 bp
  • C to T, chromosome 9 at 121,789,522 bp
  • T to C, chromosome 10 at 23,152,012 bp
  • T to C, chromosome 10 at 68,516,381 bp
  • A to T, chromosome 10 at 80,009,028 bp
  • T to C, chromosome 10 at 103,200,698 bp
  • T to A, chromosome 10 at 128,269,217 bp
  • T to C, chromosome 11 at 67,221,376 bp
  • T to C, chromosome 11 at 73,711,652 bp
  • A to T, chromosome 11 at 90,606,985 bp
  • T to C, chromosome 11 at 94,068,975 bp
  • T to C, chromosome 12 at 112,786,990 bp
  • T to C, chromosome 13 at 40,287,979 bp
  • T to A, chromosome 13 at 89,690,687 bp
  • T to A, chromosome 14 at 20,690,800 bp
  • C to T, chromosome 14 at 53,876,734 bp
  • A to C, chromosome 14 at 73,278,454 bp
  • T to A, chromosome 17 at 21,433,742 bp
  • A to G, chromosome 17 at 80,349,589 bp
  • C to A, chromosome 18 at 5,213,603 bp
  • A to T, chromosome 18 at 34,952,712 bp
  • A to T, chromosome 18 at 35,700,910 bp
  • A to T, chromosome 18 at 37,959,844 bp
  • A to G, chromosome 19 at 57,079,839 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6460 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044595-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.