Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6587Btlr/Mmmh
Stock Number:
044711-MU
Citation ID:
RRID:MMRRC_044711-MU
Other Names:
R6587 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Fiz1
Name: Flt3 interacting zinc finger protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23877
Homologene: 22663
Mindy3
Name: MINDY lysine 48 deubiquitinase 3
Synonyms: 1810041E18Rik, 5830410F13Rik, 2310047O13Rik, Fam188a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66960
Homologene: 11478
Arhgap39
Name: Rho GTPase activating protein 39
Synonyms: D15Wsu169e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223666
Homologene: 27825
Ghitm
Name: growth hormone inducible transmembrane protein
Synonyms: PTD010, 1010001P14Rik, C77840, Tmbim5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66092
VEGA: 14
Homologene: 8667
Urb2
Name: URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382038
Homologene: 8859
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Zcchc11, Tent3a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Anapc2
Name: anaphase promoting complex subunit 2
Synonyms: expressed during mesenchymal induction 4, Emi4, APC2, 9230107K09Rik, Imi4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99152
Homologene: 8359
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Camkmt
Name: calmodulin-lysine N-methyltransferase
Synonyms: 1700106N22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73582
VEGA: 17
Homologene: 11704
Zp3
Name: zona pellucida glycoprotein 3
Synonyms: Zp-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22788
Homologene: 5178
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Tulp4
Name: TUB like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Krt78
Name: keratin 78
Synonyms: 2310030B04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 332131
VEGA: 15
Homologene: 65261
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Tmem260
Name: transmembrane protein 260
Synonyms: 6720456H20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218989
Homologene: 49506
Pcdhb7
Name: protocadherin beta 7
Synonyms: Pcdhb4B, PcdhbG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93878
HGNC: HGNC:8689
Homologene: 87123
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Slc23a2
Name: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: YSPL3, SVCT2, Slc23a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54338
Homologene: 68440
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Chil6
Name: chitinase-like 6
Synonyms: BYm, BC051070
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229688
Homologene: 77638
Cyp3a44
Name: cytochrome P450, family 3, subfamily a, polypeptide 44
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 337924
HGNC: HGNC:2638
Homologene: 133568
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545366
Homologene: 134349
Pgap6
Name: post-glycosylphosphatidylinositol attachment to proteins 6
Synonyms: M83, Rxylt1, Tmem8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 60455
Homologene: 10944
Lpar3
Name: lysophosphatidic acid receptor 3
Synonyms: LPA3, Edg7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65086
Homologene: 8123
Or5b114
Name: olfactory receptor family 5 subfamily B member 114
Synonyms: GA_x6K02T2RE5P-3706029-3706953, MOR202-21, Or5b114-ps1, Olfr1468-ps1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258192
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 139,810,858 bp
  • T to C, chromosome 1 at 189,658,374 bp
  • G to A, chromosome 2 at 12,348,116 bp
  • TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG to TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG, chromosome 2 at 25,272,538 bp
  • C to A, chromosome 2 at 110,797,904 bp
  • C to T, chromosome 2 at 132,078,481 bp
  • T to C, chromosome 3 at 106,404,881 bp
  • T to C, chromosome 3 at 146,241,163 bp
  • C to A, chromosome 4 at 108,479,449 bp
  • A to C, chromosome 5 at 122,664,550 bp
  • A to G, chromosome 5 at 135,987,498 bp
  • T to C, chromosome 5 at 145,805,759 bp
  • C to T, chromosome 7 at 5,008,401 bp
  • T to C, chromosome 7 at 110,440,975 bp
  • G to T, chromosome 8 at 124,031,125 bp
  • T to C, chromosome 9 at 110,455,426 bp
  • G to T, chromosome 10 at 69,990,152 bp
  • A to T, chromosome 14 at 37,125,189 bp
  • A to G, chromosome 14 at 48,496,456 bp
  • G to T, chromosome 15 at 58,121,048 bp
  • A to G, chromosome 15 at 76,737,499 bp
  • T to C, chromosome 15 at 101,952,269 bp
  • T to G, chromosome 16 at 79,071,429 bp
  • C to T, chromosome 17 at 6,231,871 bp
  • C to T, chromosome 17 at 20,268,463 bp
  • G to A, chromosome 17 at 26,121,564 bp
  • T to C, chromosome 17 at 85,113,815 bp
  • T to G, chromosome 18 at 37,344,103 bp
  • A to T, chromosome 19 at 13,375,613 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6587 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044711-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.