Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6819Btlr/Mmmh
Stock Number:
044931-MU
Citation ID:
RRID:MMRRC_044931-MU
Other Names:
R6819 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, DPEAAE, Cspg2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Arfgap1
Name: ADP-ribosylation factor GTPase activating protein 1
Synonyms: ARF1 GAP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228998
Homologene: 5517
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Cuzd1
Name: CUB and zona pellucida-like domains 1
Synonyms: UTCZP, UO-44, ERG-1, Itmap1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16433
Homologene: 7389
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Per1
Name: period circadian clock 1
Synonyms: m-rigui, mPer1, Hftm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18626
HGNC: HGNC:8845
Homologene: 1966
Frmd8
Name: FERM domain containing 8
Synonyms: 4931429L16Rik, 2310035N23Rik, 1200004M23Rik, iTAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67457
Homologene: 32653
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Ssh1
Name: slingshot protein phosphatase 1
Synonyms: mSSH-1L, LOC384311
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231637
Homologene: 41299
Serpina10
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Synonyms: PZI
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217847
Homologene: 9414
Kcnv1
Name: potassium channel, subfamily V, member 1
Synonyms: 2700023A03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67498
VEGA: 15
Homologene: 22811
Rundc3a
Name: RUN domain containing 3A
Synonyms: Rpip8, Rap2ip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 51799
Homologene: 4871
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66435
Homologene: 56875
Adal
Name: adenosine deaminase-like
Synonyms: 4930578F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75894
Homologene: 13827
Or10g9b
Name: olfactory receptor family 10 subfamily G member 9B
Synonyms: GA_x6K02T2PVTD-33705428-33704496, MOR223-2, Olfr980
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259110
VEGA: 9
Homologene: 81557
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Jag2
Name: jagged 2
Synonyms: Serh, D12Ggc2e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16450
VEGA: 12
HGNC: HGNC:6189
Homologene: 1677
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, Dnaic2, b2b3405Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Ica1
Name: islet cell autoantigen 1
Synonyms: ICA69, 69kDa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15893
HGNC: HGNC:5343
Homologene: 7777
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Tm2d3
Name: TM2 domain containing 3
Synonyms: 5930422O05Rik, 1110025I09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68634
Homologene: 12275
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Fuca1
Name: fucosidase, alpha-L- 1, tissue
Synonyms: Afuc, 0610006A03Rik, 9530055J05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71665
HGNC: HGNC:4006
Homologene: 20078
Or10g3b
Name: olfactory receptor family 10 subfamily G member 3B
Synonyms: GA_x6K02T2RJGY-644134-645075, MOR223-10, MOR223-7P, Olfr1513
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258008
HGNC: HGNC:8171
Homologene: 79404
Ms4a8a
Name: membrane-spanning 4-domains, subfamily A, member 8A
Synonyms: 2010004L09Rik, CD20L5, Ms4a8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 64381
Homologene: 111037
Pate2
Name: prostate and testis expressed 2
Synonyms: LOC330921, mANLP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330921
Homologene: 86016
Or8g54
Name: olfactory receptor family 8 subfamily G member 54
Synonyms: GA_x6K02T2PVTD-33492981-33493916, MOR171-7, Olfr969
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258823
VEGA: 9
Homologene: 121532
Ebpl
Name: emopamil binding protein-like
Synonyms: 5730442K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68177
VEGA: 14
Homologene: 12243
Scrn3
Name: secernin 3
Synonyms: 4833415E20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74616
Homologene: 11601
Zg16
Name: zymogen granule protein 16
Synonyms: 1810010M01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69036
Homologene: 12296
Rbp2
Name: retinol binding protein 2, cellular
Synonyms: Crbp-2, Rbp-2, CrbpII
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19660
HGNC: HGNC:9920
Homologene: 3070
Slc25a51
Name: solute carrier family 25, member 51
Synonyms: D130005A03Rik, 9130208E07Rik, Mcart1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230125
Homologene: 88487
Gfy
Name: golgi-associated olfactory signaling regulator
Synonyms: Gm581, Goofy
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100039953
Homologene: 85248
Zfp987
Name: zinc finger protein 987
Synonyms: OTTMUSG00000010104, Gm13051
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 626316
Homologene: 133076
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,391,812 bp
  • C to A, chromosome 1 at 88,242,420 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • C to T, chromosome 2 at 73,319,482 bp
  • T to A, chromosome 2 at 121,148,313 bp
  • T to C, chromosome 2 at 180,971,685 bp
  • T to A, chromosome 4 at 41,715,259 bp
  • A to T, chromosome 4 at 45,399,365 bp
  • A to G, chromosome 4 at 90,224,699 bp
  • T to C, chromosome 4 at 135,932,956 bp
  • C to A, chromosome 4 at 146,125,745 bp
  • T to A, chromosome 5 at 84,106,790 bp
  • T to G, chromosome 5 at 109,340,546 bp
  • G to T, chromosome 5 at 113,946,790 bp
  • G to T, chromosome 6 at 8,742,288 bp
  • T to C, chromosome 7 at 45,177,551 bp
  • A to G, chromosome 7 at 65,697,778 bp
  • G to A, chromosome 7 at 127,050,520 bp
  • A to T, chromosome 7 at 131,309,731 bp
  • T to A, chromosome 7 at 141,858,863 bp
  • G to A, chromosome 8 at 111,187,881 bp
  • T to G, chromosome 8 at 112,803,226 bp
  • T to A, chromosome 9 at 35,670,505 bp
  • T to A, chromosome 9 at 39,795,609 bp
  • T to A, chromosome 9 at 40,006,548 bp
  • T to A, chromosome 9 at 98,509,561 bp
  • A to C, chromosome 9 at 114,615,055 bp
  • G to T, chromosome 11 at 69,101,458 bp
  • A to G, chromosome 11 at 86,110,441 bp
  • A to T, chromosome 11 at 102,398,461 bp
  • A to G, chromosome 11 at 114,745,091 bp
  • T to G, chromosome 12 at 103,142,008 bp
  • T to A, chromosome 12 at 103,628,360 bp
  • C to A, chromosome 12 at 112,910,541 bp
  • T to C, chromosome 13 at 89,705,125 bp
  • A to G, chromosome 14 at 52,349,699 bp
  • G to T, chromosome 14 at 61,341,246 bp
  • A to G, chromosome 14 at 119,026,435 bp
  • T to A, chromosome 15 at 6,796,036 bp
  • T to C, chromosome 15 at 25,781,410 bp
  • G to T, chromosome 15 at 45,109,117 bp
  • T to C, chromosome 16 at 22,060,836 bp
  • T to C, chromosome 16 at 44,492,825 bp
  • C to A, chromosome 17 at 24,287,793 bp
  • C to T, chromosome 17 at 74,367,286 bp
  • A to G, chromosome 18 at 5,591,917 bp
  • T to C, chromosome 19 at 5,865,180 bp
  • T to A, chromosome 19 at 11,076,379 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6819 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044931-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.