Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7112Btlr/Mmmh
Stock Number:
045204-MU
Citation ID:
RRID:MMRRC_045204-MU
Other Names:
R7112 (G1)
Major Collection:

Strain Information

Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: 1700105C21Rik, Tsga, C230043E16Rik, Jmjd1, Jmjd1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8, Sec8l1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20336
Homologene: 40654
Rere
Name: arginine glutamic acid dipeptide (RE) repeats
Synonyms: 1110033A15Rik, atrophin-2, Atr2, eyem03Jus, eyes3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68703
HGNC: HGNC:9965
Homologene: 8101
Wdr33
Name: WD repeat domain 33
Synonyms: 2810021O11Rik, 8430413N20Rik, 2310011G05Rik, 1110001N06Rik, WDC146
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74320
VEGA: 18
Homologene: 56807
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC333789, LOC386488, B3bp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333789
Homologene: 32396
Tbr1
Name: T-box brain transcription factor 1
Synonyms: T-box brain gene 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21375
Homologene: 4807
Cul7
Name: cullin 7
Synonyms: p193, 2510004L20Rik, p185, C230011P08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66515
Homologene: 56683
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Tcp1
Name: t-complex protein 1
Synonyms: Ccta, c-cpn, TRic, CCT, Tcp-1, Tp63, p63, Cct1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21454
Homologene: 5656
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Bcl2l11
Name: BCL2 like 11
Synonyms: Bod, Bim, 1500006F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12125
HGNC: HGNC:994
Homologene: 7643
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Mtfr2
Name: mitochondrial fission regulator 2
Synonyms: 4933412C16Rik, 2610016C23Rik, Fam54a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71804
VEGA: 10
Homologene: 69441
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Scgb2a2
Name: secretoglobin, family 2A, member 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 102639117
Homologene: 43796
Mplkipl1
Name: M-phase specific PLK1 intereacting protein like 1
Synonyms: Gm7102
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 633057
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Ret
Name: ret proto-oncogene
Synonyms: RET51, RET9, c-Ret
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19713
HGNC: HGNC:9967
Homologene: 7517
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Tpgs2
Name: tubulin polyglutamylase complex subunit 2
Synonyms: 5730437P09Rik, 5730494M16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66648
Homologene: 9161
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: vascular endothelial growth factor receptor-1, VEGFR-1, VEGFR1, Flt-1, sFlt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Tro
Name: trophinin
Synonyms: necdin and trophinin like, Tnn, trophinin-2, magphinin-gamma, magphinin-beta 2, magphinin-alpha, magphinin, Maged3l, Maged3, Trol
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 56191
Homologene: 75113
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Qprt
Name: quinolinate phosphoribosyltransferase
Synonyms: QPRTase, nicotinate-nucleotide pyrophosphorylase, 2410027J01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67375
HGNC: HGNC:9755
Homologene: 8623
Or4k5
Name: olfactory receptor family 4 subfamily K member 5
Synonyms: GA_x6K02T2PMLR-5839874-5838903, MOR246-6, Olfr729
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258275
Homologene: 17167
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333315
Homologene: 35388
Folh1
Name: folate hydrolase 1
Synonyms: mopsm, prostate-specific membrane antigen, glutamate carboxypeptidase II, GCP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53320
Homologene: 55826
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
Trim40
Name: tripartite motif-containing 40
Synonyms: LOC240093, LOC195359, LOC333872
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 195359
Homologene: 34709
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Or11h7
Name: olfactory receptor family 11 subfamily H member 7
Synonyms: GA_x6K02T2PMLR-6372116-6373060, MOR106-12, Olfr746
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258295
Homologene: 134081
Tsr3
Name: TSR3 20S rRNA accumulation
Synonyms: 1110014B11Rik, 0610007P22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68327
VEGA: 17
Homologene: 6922
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Slco4c1
Name: solute carrier organic anion transporter family, member 4C1
Synonyms: SLC21A20, PRO2176, OATP4C1, OATP-M1, OATP-H, C330017E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227394
Homologene: 62654
Gba2
Name: glucosidase beta 2
Synonyms: bile acid
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230101
Homologene: 10859
Zfp780b
Name: zinc finger protein 780B
Synonyms: B230208L21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338354
Homologene: 85969
Or8s5
Name: olfactory receptor family 8 subfamily S member 5
Synonyms: GA_x6K02T2NBG7-5395976-5396893, MOR160-4, Olfr284
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 258278
Homologene: 74250
Rab11fip5
Name: RAB11 family interacting protein 5 (class I)
Synonyms: 9130206P09Rik, RIP11, GAF1, D6Ertd32e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52055
Homologene: 9158
Fndc5
Name: fibronectin type III domain containing 5
Synonyms: PeP, 1500001L03Rik, Pxp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384061
Homologene: 17812
Bcl2l12
Name: BCL2 like 12
Synonyms: Bcl-L12, Bcl2-L12, 2810475P17Rik, 5430429M05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75736
Homologene: 12619
Ces3a
Name: carboxylesterase 3A
Synonyms: Es-male carboxylesterase, Es31
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382053
HGNC: HGNC:1865
Homologene: 84407
Or8b48
Name: olfactory receptor family 8 subfamily B member 48
Synonyms: GA_x6K02T2PVTD-32283590-32284522, MOR165-4, Olfr912
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258806
VEGA: 9
Homologene: 115510
Gpt2
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: ALT2, 4631422C05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108682
Homologene: 68832
Jph2
Name: junctophilin 2
Synonyms: JP-2, 1110002E14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59091
Homologene: 10714
Or52r1b
Name: olfactory receptor family 52 subfamily R member 1B
Synonyms: GA_x6K02T2PBJ9-5752857-5753801, MOR30-3, Olfr582
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259055
Homologene: 73943
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13318, Gm13364, Diet1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 4,349,018 bp
  • T to G, chromosome 1 at 8,448,065 bp
  • G to A, chromosome 1 at 74,416,002 bp
  • T to G, chromosome 1 at 96,841,141 bp
  • A to G, chromosome 2 at 15,925,176 bp
  • A to G, chromosome 2 at 24,690,761 bp
  • A to T, chromosome 2 at 59,962,184 bp
  • A to G, chromosome 2 at 61,811,816 bp
  • T to A, chromosome 2 at 128,158,315 bp
  • G to A, chromosome 2 at 163,375,784 bp
  • A to G, chromosome 4 at 43,568,453 bp
  • A to G, chromosome 4 at 98,761,521 bp
  • G to A, chromosome 4 at 108,650,322 bp
  • A to G, chromosome 4 at 129,142,122 bp
  • A to G, chromosome 4 at 150,406,604 bp
  • A to G, chromosome 5 at 65,790,707 bp
  • G to C, chromosome 5 at 147,603,569 bp
  • A to T, chromosome 6 at 33,921,488 bp
  • T to A, chromosome 6 at 71,632,170 bp
  • T to A, chromosome 6 at 85,348,194 bp
  • A to T, chromosome 6 at 118,197,102 bp
  • A to T, chromosome 7 at 27,963,141 bp
  • C to T, chromosome 7 at 44,996,914 bp
  • C to T, chromosome 7 at 48,168,907 bp
  • A to T, chromosome 7 at 64,235,845 bp
  • A to G, chromosome 7 at 86,775,637 bp
  • A to G, chromosome 7 at 102,408,408 bp
  • G to A, chromosome 7 at 103,041,655 bp
  • T to A, chromosome 7 at 105,713,985 bp
  • A to G, chromosome 7 at 127,108,189 bp
  • A to T, chromosome 7 at 141,649,277 bp
  • C to A, chromosome 8 at 16,101,128 bp
  • A to T, chromosome 8 at 80,612,031 bp
  • G to A, chromosome 8 at 85,518,052 bp
  • T to C, chromosome 8 at 99,196,352 bp
  • A to T, chromosome 8 at 105,057,962 bp
  • T to A, chromosome 9 at 38,582,034 bp
  • A to G, chromosome 9 at 119,754,809 bp
  • A to G, chromosome 10 at 20,357,566 bp
  • G to C, chromosome 11 at 59,029,325 bp
  • A to G, chromosome 11 at 69,735,309 bp
  • T to A, chromosome 12 at 25,004,019 bp
  • C to T, chromosome 12 at 70,102,799 bp
  • G to T, chromosome 12 at 112,783,119 bp
  • T to G, chromosome 14 at 50,147,935 bp
  • T to A, chromosome 14 at 50,654,126 bp
  • T to A, chromosome 15 at 98,340,540 bp
  • T to A, chromosome 17 at 3,163,029 bp
  • A to G, chromosome 17 at 12,917,873 bp
  • A to T, chromosome 17 at 18,105,618 bp
  • A to G, chromosome 17 at 25,240,471 bp
  • G to A, chromosome 17 at 30,871,392 bp
  • C to A, chromosome 17 at 36,882,642 bp
  • G to T, chromosome 17 at 46,651,698 bp
  • T to C, chromosome 18 at 25,149,137 bp
  • C to T, chromosome 18 at 31,893,003 bp
  • T to C, chromosome 18 at 32,839,451 bp
  • T to A, chromosome 18 at 77,388,514 bp
  • A to G, chromosome 19 at 9,851,657 bp
  • T to C, chromosome 19 at 53,010,107 bp
  • T to G, chromosome 19 at 61,175,559 bp
  • GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC to GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC, chromosome X at 150,645,856 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7112 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045204-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.