Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7189Btlr/Mmmh
Stock Number:
045238-MU
Citation ID:
RRID:MMRRC_045238-MU
Other Names:
R7189 (G1)
Major Collection:

Strain Information

Chrna7
Name: cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms: Acra7, alpha7, alpha7 nicotinic receptor, alpha7-nAChR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11441
Homologene: 593
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Zbtb43
Name: zinc finger and BTB domain containing 43
Synonyms: 1700010E06Rik, Zfp297b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71834
Homologene: 8514
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Parvb
Name: parvin, beta
Synonyms: D15Gsk1, affixin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170736
Homologene: 8342
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 45,333,657 bp
  • G to C, chromosome 1 at 46,242,142 bp
  • T to C, chromosome 1 at 75,313,430 bp
  • C to T, chromosome 1 at 87,191,058 bp
  • A to G, chromosome 1 at 132,019,389 bp
  • A to T, chromosome 1 at 132,052,393 bp
  • A to G, chromosome 1 at 132,517,086 bp
  • G to T, chromosome 1 at 194,801,058 bp
  • A to G, chromosome 2 at 33,462,295 bp
  • A to G, chromosome 2 at 82,993,237 bp
  • G to A, chromosome 2 at 85,045,562 bp
  • G to T, chromosome 2 at 103,567,516 bp
  • T to A, chromosome 2 at 111,621,193 bp
  • A to T, chromosome 3 at 68,617,699 bp
  • G to T, chromosome 3 at 68,617,700 bp
  • T to A, chromosome 3 at 79,886,807 bp
  • T to A, chromosome 3 at 87,848,361 bp
  • T to C, chromosome 4 at 101,814,764 bp
  • T to C, chromosome 4 at 120,132,219 bp
  • T to C, chromosome 4 at 137,533,561 bp
  • C to T, chromosome 4 at 138,909,554 bp
  • C to A, chromosome 5 at 14,521,918 bp
  • T to A, chromosome 5 at 54,116,128 bp
  • T to A, chromosome 5 at 94,537,751 bp
  • A to G, chromosome 5 at 106,901,703 bp
  • A to T, chromosome 5 at 146,003,060 bp
  • T to C, chromosome 5 at 149,630,460 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • T to A, chromosome 7 at 11,880,548 bp
  • T to C, chromosome 7 at 63,106,027 bp
  • T to G, chromosome 7 at 85,754,917 bp
  • A to T, chromosome 7 at 104,881,141 bp
  • A to T, chromosome 7 at 125,460,931 bp
  • C to A, chromosome 7 at 141,861,061 bp
  • A to T, chromosome 8 at 83,692,673 bp
  • T to C, chromosome 9 at 75,004,351 bp
  • G to T, chromosome 9 at 95,862,791 bp
  • T to A, chromosome 9 at 101,126,422 bp
  • C to A, chromosome 9 at 121,664,554 bp
  • C to A, chromosome 10 at 5,424,295 bp
  • G to A, chromosome 10 at 38,965,733 bp
  • G to A, chromosome 10 at 41,464,476 bp
  • C to A, chromosome 10 at 92,937,728 bp
  • G to T, chromosome 11 at 70,137,043 bp
  • C to G, chromosome 11 at 91,577,137 bp
  • T to C, chromosome 11 at 105,095,864 bp
  • G to T, chromosome 12 at 17,373,561 bp
  • C to T, chromosome 12 at 78,712,208 bp
  • T to C, chromosome 12 at 84,348,646 bp
  • A to T, chromosome 13 at 11,883,123 bp
  • A to G, chromosome 13 at 54,221,251 bp
  • A to G, chromosome 13 at 118,789,123 bp
  • T to A, chromosome 14 at 12,296,672 bp
  • A to G, chromosome 14 at 46,383,999 bp
  • T to C, chromosome 15 at 84,303,471 bp
  • C to A, chromosome 16 at 72,960,151 bp
  • A to G, chromosome 17 at 52,894,117 bp
  • C to T, chromosome 18 at 15,062,643 bp
  • A to G, chromosome 19 at 5,893,022 bp
  • A to T, chromosome 19 at 38,760,137 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7189 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045238-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.