Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7409Btlr/Mmmh
Stock Number:
045490-MU
Citation ID:
RRID:MMRRC_045490-MU
Other Names:
R7409 (G1)
Major Collection:

Strain Information

Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM, TC1460681
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Gfap
Name: glial fibrillary acidic protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14580
HGNC: HGNC:4235
Homologene: 1554
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 172,495,274 bp
  • T to A, chromosome 1 at 174,042,533 bp
  • A to G, chromosome 1 at 183,318,874 bp
  • A to T, chromosome 2 at 70,973,343 bp
  • G to T, chromosome 2 at 76,005,984 bp
  • T to C, chromosome 2 at 76,758,976 bp
  • T to C, chromosome 2 at 152,004,166 bp
  • C to A, chromosome 2 at 155,199,382 bp
  • T to G, chromosome 2 at 180,585,342 bp
  • T to C, chromosome 2 at 180,911,993 bp
  • A to G, chromosome 3 at 22,203,190 bp
  • A to G, chromosome 3 at 90,273,952 bp
  • T to C, chromosome 3 at 100,027,231 bp
  • A to T, chromosome 3 at 100,034,159 bp
  • G to A, chromosome 3 at 103,812,158 bp
  • T to A, chromosome 4 at 10,881,834 bp
  • T to A, chromosome 4 at 41,021,830 bp
  • T to A, chromosome 4 at 123,504,470 bp
  • C to T, chromosome 4 at 130,019,069 bp
  • T to C, chromosome 4 at 144,068,491 bp
  • C to T, chromosome 4 at 145,141,254 bp
  • C to A, chromosome 5 at 108,808,583 bp
  • T to C, chromosome 5 at 112,874,105 bp
  • T to A, chromosome 5 at 118,754,321 bp
  • A to T, chromosome 5 at 127,604,678 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 41,048,590 bp
  • A to C, chromosome 6 at 84,149,682 bp
  • A to T, chromosome 6 at 134,921,317 bp
  • A to G, chromosome 6 at 147,055,983 bp
  • T to A, chromosome 7 at 56,414,397 bp
  • T to C, chromosome 7 at 80,285,269 bp
  • T to C, chromosome 7 at 82,697,913 bp
  • C to T, chromosome 7 at 140,345,405 bp
  • G to A, chromosome 7 at 141,067,003 bp
  • C to A, chromosome 7 at 141,259,292 bp
  • T to C, chromosome 7 at 143,109,415 bp
  • G to A, chromosome 8 at 46,192,696 bp
  • C to A, chromosome 8 at 61,958,578 bp
  • T to C, chromosome 8 at 70,597,967 bp
  • T to G, chromosome 8 at 81,952,685 bp
  • T to G, chromosome 8 at 84,533,402 bp
  • A to G, chromosome 8 at 105,692,791 bp
  • T to C, chromosome 9 at 40,327,431 bp
  • C to G, chromosome 9 at 65,324,247 bp
  • A to C, chromosome 9 at 78,328,612 bp
  • A to G, chromosome 10 at 91,067,246 bp
  • A to G, chromosome 10 at 103,408,302 bp
  • A to G, chromosome 10 at 129,093,212 bp
  • A to T, chromosome 10 at 129,912,251 bp
  • T to G, chromosome 11 at 62,876,780 bp
  • T to C, chromosome 11 at 71,122,808 bp
  • G to T, chromosome 11 at 78,268,757 bp
  • C to T, chromosome 11 at 102,894,532 bp
  • T to G, chromosome 12 at 33,436,989 bp
  • T to C, chromosome 12 at 57,696,986 bp
  • A to T, chromosome 12 at 85,344,291 bp
  • T to C, chromosome 12 at 111,540,263 bp
  • C to T, chromosome 12 at 113,422,232 bp
  • A to T, chromosome 13 at 92,773,259 bp
  • T to A, chromosome 13 at 100,611,476 bp
  • T to C, chromosome 14 at 20,552,245 bp
  • A to T, chromosome 14 at 50,866,855 bp
  • A to T, chromosome 14 at 52,007,113 bp
  • A to T, chromosome 14 at 57,124,153 bp
  • G to A, chromosome 14 at 57,286,385 bp
  • A to C, chromosome 14 at 78,982,234 bp
  • A to T, chromosome 14 at 103,288,744 bp
  • A to G, chromosome 15 at 63,833,346 bp
  • A to G, chromosome 15 at 84,197,030 bp
  • G to T, chromosome 15 at 98,855,354 bp
  • T to C, chromosome 16 at 17,807,054 bp
  • A to G, chromosome 16 at 90,869,656 bp
  • C to T, chromosome 17 at 23,559,629 bp
  • C to T, chromosome 17 at 31,340,263 bp
  • T to A, chromosome 17 at 35,614,518 bp
  • T to C, chromosome 17 at 51,809,189 bp
  • T to A, chromosome 17 at 75,516,416 bp
  • T to A, chromosome 17 at 78,839,166 bp
  • T to C, chromosome 18 at 32,127,460 bp
  • C to A, chromosome 18 at 36,530,805 bp
  • C to G, chromosome 18 at 36,770,113 bp
  • A to G, chromosome 18 at 65,306,952 bp
  • G to C, chromosome 18 at 67,834,803 bp
  • T to C, chromosome 19 at 43,890,557 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7409 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045490-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.