Strain Name:
C57BL/6J-MtgxR7409Btlr/Mmmh
Stock Number:
045490-MU
Citation ID:
RRID:MMRRC_045490-MU
Other Names:
R7409 (G1)
Major Collection:

Strain Information

Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Gfap
Name: glial fibrillary acidic protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14580
HGNC: HGNC:4235
Homologene: 1554
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Tmed10
Name: transmembrane p24 trafficking protein 10
Synonyms: 1110014C03Rik, p24delta1, p23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68581
VEGA: 12
Homologene: 4972
Cdkn1b
Name: cyclin dependent kinase inhibitor 1B
Synonyms: p27Kip1, p27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12576
HGNC: HGNC:1785
Homologene: 2999
Polr1f
Name: RNA polymerase I subunit F
Synonyms: D16Wsu83e, 2810024J17Rik, Twistnb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 28071
VEGA: 12
Homologene: 45411
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Ssbp4
Name: single stranded DNA binding protein 4
Synonyms: 1210002E11Rik, Ssdp4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76900
Homologene: 41881
Slc37a1
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 1
Synonyms: G3PP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224674
VEGA: 17
Homologene: 70486
Ythdf1
Name: YTH N6-methyladenosine RNA binding protein 1
Synonyms: 2210410K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228994
Homologene: 9844
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Hars1
Name: histidyl-tRNA synthetase 1
Synonyms: MMHRS, Hars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15115
VEGA: 18
HGNC: HGNC:4816
Homologene: 1592
Nfx1
Name: nuclear transcription factor, X-box binding 1
Synonyms: TEG-42, 3000003M19Rik, 1300017N15Rik, Tex42
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74164
HGNC: HGNC:7803
Homologene: 1875
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Tbl1xr1
Name: transducin (beta)-like 1X-linked receptor 1
Synonyms: Ira1, TBLR1, DC42, C21, C230089I12Rik, A630076E03Rik, 8030499H02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81004
Homologene: 69382
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Mrps35
Name: mitochondrial ribosomal protein S35
Synonyms: MRP-S28, MRPS28, MDSO23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232536
Homologene: 11048
Eif5
Name: eukaryotic translation initiation factor 5
Synonyms: D12Ertd549e, 2810011H21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217869
VEGA: 12
HGNC: HGNC:3299
Homologene: 49610
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Zfp219
Name: zinc finger protein 219
Synonyms: 2010302A17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69890
VEGA: 14
Homologene: 9504
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Eva1c
Name: eva-1 homolog C
Synonyms: 1700092M14Rik, Fam176c, 4931408A02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70967
Homologene: 14383
Igsf9
Name: immunoglobulin superfamily, member 9
Synonyms: NRT1, Dasm1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93842
Homologene: 10815
Cfap97
Name: cilia and flagella associated protein 97
Synonyms: 1110068E21Rik, 4933411K20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66756
Homologene: 12026
Usp54
Name: ubiquitin specific peptidase 54
Synonyms: 4930429G18Rik, C030002J06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78787
Homologene: 90902
Slc15a4
Name: solute carrier family 15, member 4
Synonyms: C130069N12Rik, PTR4, PHT1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100561
Homologene: 26432
Efl1
Name: elongation factor like GTPase 1
Synonyms: 4932434J20Rik, 6030468D11Rik, D7Ertd791e, Eftud1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101592
Homologene: 11599
Mettl8
Name: methyltransferase 8, methylcytidine
Synonyms: TIP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228019
Homologene: 11706
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Marveld2
Name: MARVEL (membrane-associating) domain containing 2
Synonyms: Mrvldc2, Tricellulin, Tric, Tric-c, Tric-b, Tric-a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218518
VEGA: 13
Homologene: 27037
Kcnq1
Name: potassium voltage-gated channel, subfamily Q, member 1
Synonyms: KVLQT1, Kcna9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16535
HGNC: HGNC:6294
Homologene: 85014
Oca2
Name: oculocutaneous albinism II
Synonyms: D7H15S12, D7H15S12, p
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18431
HGNC: HGNC:8101
Homologene: 37281
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rasgrp3
Name: RAS, guanyl releasing protein 3
Synonyms: LOC240168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240168
VEGA: 17
Homologene: 15019
Mrgbp
Name: MRG/MORF4L binding protein
Synonyms: 1600027N09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73247
Homologene: 10104
Bltp2
Name: bridge-like lipid transfer protein family member 2
Synonyms: 2610507B11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72503
Homologene: 34730
Pramel4
Name: PRAME like 4
Synonyms: D4Ertd792e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 347710
Homologene: 133722
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Slc4a9
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms: AE4, D630024F24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240215
VEGA: 18
Homologene: 23732
Ap4b1
Name: adaptor-related protein complex AP-4, beta 1
Synonyms: AP-4 beta-4, 1810038H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67489
HGNC: HGNC:572
Homologene: 38203
Gramd1b
Name: GRAM domain containing 1B
Synonyms: A930008A22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235283
Homologene: 18223
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234311
Homologene: 23031
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Proc
Name: protein C
Synonyms: inactivator of coagulation factors Va, VIII, PC
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19123
VEGA: 18
HGNC: HGNC:9451
Homologene: 37288
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Slc52a3
Name: solute carrier protein family 52, member 3
Synonyms: 2310046K01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69698
Homologene: 12324
Vps33b
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233405
Homologene: 10261
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Pde11a
Name: phosphodiesterase 11A
Synonyms: A630086N24Rik, 6330414F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627479
Homologene: 129606
Cryl1
Name: crystallin, lambda 1
Synonyms: 1110025H08Rik, A230106J09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68631
VEGA: 14
Homologene: 9322
Or6c69
Name: olfactory receptor family 6 subfamily C member 69
Synonyms: GA_x6K02T2PULF-11590830-11589892, MOR113-1, Olfr816
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258667
Homologene: 133584
Or13a27
Name: olfactory receptor family 13 subfamily A member 27
Synonyms: IH6, MOR253-6, GA_x6K02T2PBJ9-42496183-42495251, Olfr60
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18361
Homologene: 34961
Omt2b
Name: oocyte maturation, beta
Synonyms: OM2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382088
Homologene: 136010
B4galnt4
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330671
Homologene: 27982
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
Samm50
Name: SAMM50 sorting and assembly machinery component
Synonyms: 1110030L07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68653
VEGA: 15
Homologene: 41034
Scarf2
Name: scavenger receptor class F, member 2
Synonyms: Srec2, SREC-II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224024
VEGA: 16
Homologene: 17817
Or10aa1
Name: olfactory receptor family 10 subfamily AA member 1
Synonyms: GA_x6K02T2P20D-21133014-21132070, MOR123-1, Olfr433
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258712
Homologene: 133588
Cfap418
Name: cilia and flagella associated protein 418
Synonyms: 2610301B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67157
Homologene: 18641
Sfta2
Name: surfactant associated 2
Synonyms: EG433102
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433102
Or6c38
Name: olfactory receptor family 6 subfamily C member 38
Synonyms: GA_x6K02T2PULF-10779441-10778503, MOR114-4, Olfr768
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258863
Homologene: 17159
Aida
Name: axin interactor, dorsalization associated
Synonyms: 2610208M17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108909
Homologene: 11268
Gpatch11
Name: G patch domain containing 11
Synonyms: 2310002B06Rik, Ccdc75
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53951
VEGA: 17
Homologene: 44687
Gjb6
Name: gap junction protein, beta 6
Synonyms: connexin 30, Cx30, D14Bwg0506e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14623
HGNC: HGNC:4288
Homologene: 4936
Zfp213
Name: zinc finger protein 213
Synonyms: D17Ertd197e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 449521
VEGA: 17
Homologene: 55809
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Trbv3
Name: T cell receptor beta, variable 3
Synonyms: Gm2426, Tcrb-V16
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100039790
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 172,495,274 bp
  • T to A, chromosome 1 at 174,042,533 bp
  • A to G, chromosome 1 at 183,318,874 bp
  • A to T, chromosome 2 at 70,973,343 bp
  • G to T, chromosome 2 at 76,005,984 bp
  • T to C, chromosome 2 at 76,758,976 bp
  • T to C, chromosome 2 at 152,004,166 bp
  • C to A, chromosome 2 at 155,199,382 bp
  • T to G, chromosome 2 at 180,585,342 bp
  • T to C, chromosome 2 at 180,911,993 bp
  • A to G, chromosome 3 at 22,203,190 bp
  • A to G, chromosome 3 at 90,273,952 bp
  • T to C, chromosome 3 at 100,027,231 bp
  • A to T, chromosome 3 at 100,034,159 bp
  • G to A, chromosome 3 at 103,812,158 bp
  • T to A, chromosome 4 at 10,881,834 bp
  • T to A, chromosome 4 at 41,021,830 bp
  • T to A, chromosome 4 at 123,504,470 bp
  • C to T, chromosome 4 at 130,019,069 bp
  • T to C, chromosome 4 at 144,068,491 bp
  • C to T, chromosome 4 at 145,141,254 bp
  • C to A, chromosome 5 at 108,808,583 bp
  • T to C, chromosome 5 at 112,874,105 bp
  • T to A, chromosome 5 at 118,754,321 bp
  • A to T, chromosome 5 at 127,604,678 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 41,048,590 bp
  • A to C, chromosome 6 at 84,149,682 bp
  • A to T, chromosome 6 at 134,921,317 bp
  • A to G, chromosome 6 at 147,055,983 bp
  • T to A, chromosome 7 at 56,414,397 bp
  • T to C, chromosome 7 at 80,285,269 bp
  • T to C, chromosome 7 at 82,697,913 bp
  • C to T, chromosome 7 at 140,345,405 bp
  • G to A, chromosome 7 at 141,067,003 bp
  • C to A, chromosome 7 at 141,259,292 bp
  • T to C, chromosome 7 at 143,109,415 bp
  • G to A, chromosome 8 at 46,192,696 bp
  • C to A, chromosome 8 at 61,958,578 bp
  • T to C, chromosome 8 at 70,597,967 bp
  • T to G, chromosome 8 at 81,952,685 bp
  • T to G, chromosome 8 at 84,533,402 bp
  • A to G, chromosome 8 at 105,692,791 bp
  • T to C, chromosome 9 at 40,327,431 bp
  • C to G, chromosome 9 at 65,324,247 bp
  • A to C, chromosome 9 at 78,328,612 bp
  • A to G, chromosome 10 at 91,067,246 bp
  • A to G, chromosome 10 at 103,408,302 bp
  • A to G, chromosome 10 at 129,093,212 bp
  • A to T, chromosome 10 at 129,912,251 bp
  • T to G, chromosome 11 at 62,876,780 bp
  • T to C, chromosome 11 at 71,122,808 bp
  • G to T, chromosome 11 at 78,268,757 bp
  • C to T, chromosome 11 at 102,894,532 bp
  • T to G, chromosome 12 at 33,436,989 bp
  • T to C, chromosome 12 at 57,696,986 bp
  • A to T, chromosome 12 at 85,344,291 bp
  • T to C, chromosome 12 at 111,540,263 bp
  • C to T, chromosome 12 at 113,422,232 bp
  • A to T, chromosome 13 at 92,773,259 bp
  • T to A, chromosome 13 at 100,611,476 bp
  • T to C, chromosome 14 at 20,552,245 bp
  • A to T, chromosome 14 at 50,866,855 bp
  • A to T, chromosome 14 at 52,007,113 bp
  • A to T, chromosome 14 at 57,124,153 bp
  • G to A, chromosome 14 at 57,286,385 bp
  • A to C, chromosome 14 at 78,982,234 bp
  • A to T, chromosome 14 at 103,288,744 bp
  • A to G, chromosome 15 at 63,833,346 bp
  • A to G, chromosome 15 at 84,197,030 bp
  • G to T, chromosome 15 at 98,855,354 bp
  • T to C, chromosome 16 at 17,807,054 bp
  • A to G, chromosome 16 at 90,869,656 bp
  • C to T, chromosome 17 at 23,559,629 bp
  • C to T, chromosome 17 at 31,340,263 bp
  • T to A, chromosome 17 at 35,614,518 bp
  • T to C, chromosome 17 at 51,809,189 bp
  • T to A, chromosome 17 at 75,516,416 bp
  • T to A, chromosome 17 at 78,839,166 bp
  • T to C, chromosome 18 at 32,127,460 bp
  • C to A, chromosome 18 at 36,530,805 bp
  • C to G, chromosome 18 at 36,770,113 bp
  • A to G, chromosome 18 at 65,306,952 bp
  • G to C, chromosome 18 at 67,834,803 bp
  • T to C, chromosome 19 at 43,890,557 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7409 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045490-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.