Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7558Btlr/Mmmh
Stock Number:
045625-MU
Citation ID:
RRID:MMRRC_045625-MU
Other Names:
R7558 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Lemd2
Name: LEM domain containing 2
Synonyms: Lem2, NET25
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224640
VEGA: 17
Homologene: 17136
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Smarcc1
Name: SWI/SNF related BAF chromatin remodeling complex subunit C1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: protein phosphatase 2A subunit beta, 4633401M22Rik, B56beta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 65,272,623 bp
  • A to T, chromosome 1 at 81,269,373 bp
  • A to G, chromosome 1 at 134,040,993 bp
  • A to T, chromosome 1 at 140,523,190 bp
  • G to A, chromosome 1 at 157,175,836 bp
  • A to G, chromosome 2 at 20,855,610 bp
  • A to T, chromosome 2 at 26,439,734 bp
  • T to C, chromosome 2 at 41,341,936 bp
  • A to T, chromosome 2 at 119,771,254 bp
  • A to G, chromosome 2 at 120,374,510 bp
  • A to T, chromosome 2 at 142,758,826 bp
  • T to C, chromosome 2 at 164,490,216 bp
  • C to T, chromosome 3 at 76,429,785 bp
  • T to A, chromosome 3 at 138,352,536 bp
  • G to T, chromosome 4 at 45,813,497 bp
  • T to G, chromosome 4 at 123,294,620 bp
  • T to G, chromosome 4 at 145,154,580 bp
  • G to T, chromosome 5 at 105,481,711 bp
  • G to A, chromosome 6 at 87,821,529 bp
  • T to C, chromosome 6 at 116,403,565 bp
  • G to T, chromosome 6 at 146,390,865 bp
  • C to A, chromosome 7 at 46,303,160 bp
  • C to G, chromosome 7 at 108,544,721 bp
  • T to C, chromosome 8 at 105,254,672 bp
  • C to A, chromosome 9 at 110,147,116 bp
  • A to T, chromosome 10 at 14,431,607 bp
  • A to T, chromosome 10 at 33,543,464 bp
  • A to G, chromosome 10 at 80,722,921 bp
  • A to G, chromosome 10 at 81,148,435 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • G to A, chromosome 10 at 127,248,079 bp
  • G to T, chromosome 11 at 23,516,285 bp
  • A to G, chromosome 11 at 40,733,329 bp
  • A to T, chromosome 11 at 69,879,590 bp
  • T to C, chromosome 11 at 121,288,058 bp
  • A to T, chromosome 12 at 75,464,992 bp
  • G to A, chromosome 13 at 11,799,825 bp
  • A to G, chromosome 13 at 38,168,766 bp
  • T to C, chromosome 14 at 66,154,179 bp
  • C to A, chromosome 14 at 123,486,385 bp
  • C to T, chromosome 15 at 8,225,367 bp
  • T to A, chromosome 15 at 27,831,394 bp
  • T to C, chromosome 15 at 101,054,383 bp
  • T to A, chromosome 16 at 20,738,554 bp
  • C to A, chromosome 16 at 32,680,085 bp
  • T to C, chromosome 16 at 79,003,414 bp
  • C to A, chromosome 17 at 27,204,163 bp
  • A to G, chromosome 17 at 35,425,619 bp
  • G to A, chromosome 18 at 20,594,234 bp
  • T to C, chromosome 18 at 65,462,834 bp
  • A to G, chromosome 18 at 78,192,119 bp
  • T to A, chromosome 19 at 7,785,286 bp
  • T to A, chromosome 19 at 13,410,991 bp
  • T to C, chromosome 19 at 18,778,665 bp
  • T to C, chromosome 19 at 59,169,984 bp
  • G to A, chromosome X at 74,306,855 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7558 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045625-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.