Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7646Btlr/Mmmh
Stock Number:
045724-MU
Citation ID:
RRID:MMRRC_045724-MU
Other Names:
R7646 (G1)
Major Collection:

Strain Information

Tnfsf4
Name: tumor necrosis factor (ligand) superfamily, member 4
Synonyms: OX40L, gp34, Txgp1l, Ath-1, TXGP1, CD134L, Ath1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22164
Homologene: 2495
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Syt4
Name: synaptotagmin IV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20983
VEGA: 18
Homologene: 7559
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Lig3
Name: ligase III, DNA, ATP-dependent
Synonyms: D11Wsu78e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16882
HGNC: HGNC:6600
Homologene: 32109
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,912,135 bp
  • T to C, chromosome 1 at 24,028,623 bp
  • A to T, chromosome 1 at 58,994,408 bp
  • A to G, chromosome 1 at 161,417,162 bp
  • C to T, chromosome 1 at 175,614,913 bp
  • A to G, chromosome 2 at 29,177,549 bp
  • T to C, chromosome 2 at 66,287,758 bp
  • C to A, chromosome 2 at 86,639,169 bp
  • A to G, chromosome 2 at 87,357,758 bp
  • G to T, chromosome 2 at 103,439,243 bp
  • T to G, chromosome 4 at 62,191,295 bp
  • T to A, chromosome 4 at 113,763,542 bp
  • T to A, chromosome 4 at 141,021,655 bp
  • T to C, chromosome 4 at 156,195,354 bp
  • A to T, chromosome 5 at 14,520,895 bp
  • A to T, chromosome 6 at 18,375,940 bp
  • A to G, chromosome 6 at 52,215,719 bp
  • T to A, chromosome 6 at 123,816,210 bp
  • A to T, chromosome 7 at 6,709,222 bp
  • G to A, chromosome 7 at 7,115,721 bp
  • A to G, chromosome 7 at 24,261,415 bp
  • C to G, chromosome 7 at 26,449,562 bp
  • T to G, chromosome 7 at 44,116,118 bp
  • A to G, chromosome 7 at 56,134,613 bp
  • G to T, chromosome 7 at 73,435,773 bp
  • G to A, chromosome 7 at 74,504,596 bp
  • G to A, chromosome 7 at 98,619,353 bp
  • A to C, chromosome 7 at 102,154,035 bp
  • G to A, chromosome 7 at 103,938,297 bp
  • G to A, chromosome 7 at 104,335,352 bp
  • A to G, chromosome 7 at 120,514,714 bp
  • A to T, chromosome 7 at 135,696,769 bp
  • A to G, chromosome 7 at 140,345,951 bp
  • T to A, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 122,024,036 bp
  • C to A, chromosome 8 at 123,493,027 bp
  • A to G, chromosome 9 at 14,308,615 bp
  • A to T, chromosome 9 at 20,470,024 bp
  • T to C, chromosome 10 at 5,172,949 bp
  • T to C, chromosome 10 at 60,305,152 bp
  • T to A, chromosome 11 at 50,410,609 bp
  • T to A, chromosome 11 at 53,537,917 bp
  • A to G, chromosome 11 at 54,625,954 bp
  • T to A, chromosome 11 at 82,783,478 bp
  • G to A, chromosome 11 at 116,132,767 bp
  • A to G, chromosome 12 at 8,009,189 bp
  • A to G, chromosome 13 at 38,022,847 bp
  • A to G, chromosome 13 at 70,589,797 bp
  • G to A, chromosome 14 at 14,773,348 bp
  • A to G, chromosome 14 at 20,724,459 bp
  • C to T, chromosome 14 at 47,399,519 bp
  • G to T, chromosome 14 at 63,606,974 bp
  • A to G, chromosome 15 at 81,917,370 bp
  • T to C, chromosome 16 at 5,018,497 bp
  • T to A, chromosome 16 at 36,721,919 bp
  • A to G, chromosome 17 at 25,860,130 bp
  • G to A, chromosome 17 at 30,649,677 bp
  • A to G, chromosome 17 at 30,936,283 bp
  • G to T, chromosome 17 at 37,624,404 bp
  • C to T, chromosome 17 at 57,059,759 bp
  • A to G, chromosome 17 at 79,854,607 bp
  • A to C, chromosome 18 at 31,441,605 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • A to T, chromosome 19 at 18,867,961 bp
  • T to A, chromosome 19 at 46,283,672 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7646 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045724-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.