Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7713Btlr/Mmmh
Stock Number:
045771-MU
Citation ID:
RRID:MMRRC_045771-MU
Other Names:
R7713 (G1)
Major Collection:

Strain Information

Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Arip4, G630026H09Rik, Srisnf2l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Yars1
Name: tyrosyl-tRNA synthetase 1
Synonyms: Yars
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107271
Homologene: 2730
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Ube4b
Name: ubiquitination factor E4B
Synonyms: UFD2, 4933406G05Rik, 4930551I19Rik, UFD2a, D4Bwg0973e, Ufd2p
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 63958
Homologene: 107623
Zfp26
Name: zinc finger protein 26
Synonyms: mkr-3, Zfp-26, 5033428C05Rik, Zfp70, KRAB15, Zfp81-rs1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22688
Homologene: 52318
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Cep128
Name: centrosomal protein 128
Synonyms: 5430424K18Rik, 4930534B04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75216
Homologene: 35315
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Osr1
Name: odd-skipped related transcription factor 1
Synonyms: Odd1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23967
VEGA: 12
HGNC: HGNC:8111
Homologene: 8035
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: Erbb-3, Erbb3r, HER3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Hapln3
Name: hyaluronan and proteoglycan link protein 3
Synonyms: Lpr3, 4930554N11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67666
Homologene: 18654
Naa35
Name: N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Synonyms: A330027C19Rik, A330021G12Rik, C030004C14Rik, Mak10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78689
Homologene: 5781
Mtmr4
Name: myotubularin related protein 4
Synonyms: ESTM44, FYVE-DSP2, FYVE zinc finger phosphatase, ZFYVE11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170749
HGNC: HGNC:7452
Homologene: 3440
G2e3
Name: G2/M-phase specific E3 ubiquitin ligase
Synonyms: D930034K21Rik, 6030408C04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217558
Homologene: 32362
Zic5
Name: zinc finger protein of the cerebellum 5
Synonyms: odd-paired related, Opr, 1700049L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65100
Homologene: 11301
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67269
Homologene: 9067
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Drc3
Name: dynein regulatory complex subunit 3
Synonyms: 4930449E07Rik, m6Bei, Lrrc48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74665
Homologene: 12581
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Fbxw7
Name: F-box and WD-40 domain protein 7
Synonyms: SEL-10, AGO, Fbxo30, Fbxw6, 1110001A17Rik, Cdc4, Fbw7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50754
Homologene: 117451
Kcnj2
Name: potassium inwardly-rectifying channel, subfamily J, member 2
Synonyms: IRK1, Kir2.1, Kcnf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16518
HGNC: HGNC:6263
Homologene: 20249
Nepn
Name: nephrocan
Synonyms: 5730521E12Rik, Npn, periolin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66650
Homologene: 23549
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Fndc7
Name: fibronectin type III domain containing 7
Synonyms: E230011A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320181
Homologene: 18551
1700113H08Rik
Name: RIKEN cDNA 1700113H08 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76640
Homologene: 45695
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Armh1
Name: armadillo-like helical domain containing 1
Synonyms: LOC381544, LOC381543, Ncrna00082, Gm1661
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381544
Homologene: 28727
Ggt1
Name: gamma-glutamyltransferase 1
Synonyms: GGT, CD224, Ggtp, dwg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14598
Homologene: 68450
Esrp2
Name: epithelial splicing regulatory protein 2
Synonyms: 9530027K23Rik, Rbm35b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77411
Homologene: 32617
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: SCaMC-1like, 4930443G12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74686
Homologene: 82464
Gnas
Name: GNAS complex locus
Synonyms: Gnas1, Gs-alpha, Gs alpha, G alpha s, Nesp55, P2, P3, P1, neuroendocrine-specific Golgi protein p55 isoform 1, XLalphas, Gsa, Nesp, Gnasxl, Nespl, Oedsml, Galphas, SCG6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14683
HGNC: HGNC:4392
Homologene: 55534
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, D11S833Eh, Garp, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Or10a3
Name: olfactory receptor family 10 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-11211854-11210853, MOR268-5, Olfr518
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258303
Homologene: 133601
Or4p8
Name: olfactory receptor family 4 subfamily P member 8
Synonyms: GA_x6K02T2Q125-50372411-50371485, MOR225-4, Olfr1208
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258774
Homologene: 74190
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Nthl1
Name: nth (endonuclease III)-like 1 (E.coli)
Synonyms: Nth1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18207
VEGA: 17
HGNC: HGNC:8028
Homologene: 1897
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 88,897,778 bp
  • T to A, chromosome 2 at 112,635,346 bp
  • C to T, chromosome 2 at 113,525,814 bp
  • G to A, chromosome 2 at 158,216,778 bp
  • C to T, chromosome 2 at 174,299,027 bp
  • T to C, chromosome 3 at 84,967,565 bp
  • C to T, chromosome 3 at 108,870,663 bp
  • T to A, chromosome 3 at 109,102,817 bp
  • A to T, chromosome 4 at 117,214,228 bp
  • G to T, chromosome 4 at 129,210,498 bp
  • C to T, chromosome 4 at 149,398,781 bp
  • A to T, chromosome 5 at 76,245,420 bp
  • C to T, chromosome 6 at 81,941,390 bp
  • T to C, chromosome 6 at 122,078,795 bp
  • C to T, chromosome 7 at 79,117,373 bp
  • G to T, chromosome 7 at 98,499,338 bp
  • A to C, chromosome 7 at 108,880,682 bp
  • T to C, chromosome 8 at 106,134,276 bp
  • T to C, chromosome 8 at 110,593,812 bp
  • G to A, chromosome 9 at 20,441,334 bp
  • G to A, chromosome 9 at 106,717,223 bp
  • T to A, chromosome 10 at 52,401,178 bp
  • T to A, chromosome 10 at 75,585,674 bp
  • T to C, chromosome 10 at 87,230,311 bp
  • T to C, chromosome 10 at 128,574,449 bp
  • A to G, chromosome 11 at 60,370,560 bp
  • A to G, chromosome 11 at 79,425,606 bp
  • T to C, chromosome 11 at 87,597,724 bp
  • T to C, chromosome 11 at 111,072,483 bp
  • C to A, chromosome 11 at 118,025,171 bp
  • A to T, chromosome 12 at 9,579,253 bp
  • C to A, chromosome 12 at 51,369,056 bp
  • A to T, chromosome 12 at 91,019,322 bp
  • T to A, chromosome 13 at 59,514,152 bp
  • T to C, chromosome 13 at 59,598,105 bp
  • T to A, chromosome 13 at 95,731,444 bp
  • T to G, chromosome 13 at 113,346,541 bp
  • T to C, chromosome 14 at 122,464,113 bp
  • A to T, chromosome 17 at 24,638,657 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • T to A, chromosome 19 at 33,973,065 bp
  • G to A, chromosome Y at 1,304,411 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7713 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045771-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.