Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7713Btlr/Mmmh
Stock Number:
045771-MU
Citation ID:
RRID:MMRRC_045771-MU
Other Names:
R7713 (G1)
Major Collection:

Strain Information

Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Arip4, G630026H09Rik, Srisnf2l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Yars1
Name: tyrosyl-tRNA synthetase 1
Synonyms: Yars
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107271
Homologene: 2730
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Ube4b
Name: ubiquitination factor E4B
Synonyms: UFD2, 4933406G05Rik, 4930551I19Rik, UFD2a, D4Bwg0973e, Ufd2p
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 63958
Homologene: 107623
Zfp26
Name: zinc finger protein 26
Synonyms: mkr-3, Zfp-26, 5033428C05Rik, Zfp70, KRAB15, Zfp81-rs1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22688
Homologene: 52318
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 88,897,778 bp
  • T to A, chromosome 2 at 112,635,346 bp
  • C to T, chromosome 2 at 113,525,814 bp
  • G to A, chromosome 2 at 158,216,778 bp
  • C to T, chromosome 2 at 174,299,027 bp
  • T to C, chromosome 3 at 84,967,565 bp
  • C to T, chromosome 3 at 108,870,663 bp
  • T to A, chromosome 3 at 109,102,817 bp
  • A to T, chromosome 4 at 117,214,228 bp
  • G to T, chromosome 4 at 129,210,498 bp
  • C to T, chromosome 4 at 149,398,781 bp
  • A to T, chromosome 5 at 76,245,420 bp
  • C to T, chromosome 6 at 81,941,390 bp
  • T to C, chromosome 6 at 122,078,795 bp
  • C to T, chromosome 7 at 79,117,373 bp
  • G to T, chromosome 7 at 98,499,338 bp
  • A to C, chromosome 7 at 108,880,682 bp
  • T to C, chromosome 8 at 106,134,276 bp
  • T to C, chromosome 8 at 110,593,812 bp
  • G to A, chromosome 9 at 20,441,334 bp
  • G to A, chromosome 9 at 106,717,223 bp
  • T to A, chromosome 10 at 52,401,178 bp
  • T to A, chromosome 10 at 75,585,674 bp
  • T to C, chromosome 10 at 87,230,311 bp
  • T to C, chromosome 10 at 128,574,449 bp
  • A to G, chromosome 11 at 60,370,560 bp
  • A to G, chromosome 11 at 79,425,606 bp
  • T to C, chromosome 11 at 87,597,724 bp
  • T to C, chromosome 11 at 111,072,483 bp
  • C to A, chromosome 11 at 118,025,171 bp
  • A to T, chromosome 12 at 9,579,253 bp
  • C to A, chromosome 12 at 51,369,056 bp
  • A to T, chromosome 12 at 91,019,322 bp
  • T to A, chromosome 13 at 59,514,152 bp
  • T to C, chromosome 13 at 59,598,105 bp
  • T to A, chromosome 13 at 95,731,444 bp
  • T to G, chromosome 13 at 113,346,541 bp
  • T to C, chromosome 14 at 122,464,113 bp
  • A to T, chromosome 17 at 24,638,657 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • T to A, chromosome 19 at 33,973,065 bp
  • G to A, chromosome Y at 1,304,411 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7713 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045771-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.