Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7746Btlr/Mmmh
Stock Number:
045802-MU
Citation ID:
RRID:MMRRC_045802-MU
Other Names:
R7746 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Strn
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268980
Homologene: 2380
Syt4
Name: synaptotagmin IV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20983
VEGA: 18
Homologene: 7559
Gpr19
Name: G protein-coupled receptor 19
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14760
HGNC: HGNC:4473
Homologene: 4476
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117599
Homologene: 50463
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Samd4b
Name: sterile alpha motif domain containing 4B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233033
Homologene: 35268
Polr1a
Name: polymerase (RNA) I polypeptide A
Synonyms: mRPA1, RPA194, 194kDa, 3010014K16Rik, Rpo1-4, 2900087K15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20019
Homologene: 7033
Cic
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71722
Homologene: 87637
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Garnl3
Name: GTPase activating RANGAP domain-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99326
Homologene: 13003
Ppp4r3b
Name: protein phosphatase 4 regulatory subunit 3B
Synonyms: Smek2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104570
Homologene: 68886
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: gp160, vp165, IRAP, 4732490P18Rik, 2010309L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Ppwd1
Name: peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms: A330090G21Rik, 4632422M10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238831
VEGA: 13
Homologene: 9099
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Bik
Name: BCL2-interacting killer
Synonyms: Blk, Nbk, Biklk
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12124
VEGA: 15
HGNC: HGNC:1051
Homologene: 924
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Serpinb9h
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9h
Synonyms: Gm11397
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544923
HGNC: HGNC:8955
Homologene: 69093
Tnn
Name: tenascin N
Synonyms: Tnw, tenascin-W
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Ankrd48
Name: ankyrin repeat domain 48
Synonyms: 1700012M14Rik, GC3, 1700008J08Rik, Ankrd36
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76389
Homologene: 137366
Ror2
Name: receptor tyrosine kinase-like orphan receptor 2
Synonyms: Ntrkr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26564
Homologene: 55831
Nprl3
Name: nitrogen permease regulator-like 3
Synonyms: -14 gene, m(alpha)RE, Prox1, HS-26, HS-40, Phg, Mare
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17168
Homologene: 8091
Or8k40
Name: olfactory receptor family 8 subfamily K member 40
Synonyms: GA_x6K02T2Q125-48247345-48246404, MOR188-4, Olfr1090
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258844
Homologene: 17413
Foxs1
Name: forkhead box S1
Synonyms: FREAC10, Fkh3, Fkhl18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14239
HGNC: HGNC:3735
Homologene: 20871
Arhgef33
Name: Rho guanine nucleotide exchange factor 33
Synonyms: LOC381112, Gm941
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381112
VEGA: 17
Homologene: 55190
Pkn3
Name: protein kinase N3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263803
Homologene: 50980
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: MOR256-7, GA_x6K02T2PSCP-2779375-2780313, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Ctif
Name: CBP80/20-dependent translation initiation factor
Synonyms: LOC269037, Gm672
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269037
VEGA: 18
Homologene: 56682
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
Dvl1
Name: dishevelled segment polarity protein 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13542
Homologene: 20926
Mlc1
Name: megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
Synonyms: Kiaa0027-hp, WKL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170790
Homologene: 15775
Acyp1
Name: acylphosphatase 1
Synonyms: 1110039O14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66204
HGNC: HGNC:179
Homologene: 11932
Pxdc1
Name: PX domain containing 1
Synonyms: 1300014I06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66895
Homologene: 12051
Tmem45a
Name: transmembrane protein 45a
Synonyms: C630002M10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56277
Homologene: 41215
Rhbdl1
Name: rhomboid like 1
Synonyms: Rhbdl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214951
Homologene: 2946
Msantd5f9
Name: Myb/SANT DNA binding domain containing 5 family member 9
Synonyms: Gm11756
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623281
Tafa1
Name: TAFA chemokine like family member 1
Synonyms: Tafa-1, C630007B19Rik, Fam19a1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320265
Homologene: 45655
Gm44501
Name: predicted readthrough transcript, 44501
Synonyms: Esp6Esp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 102577428
VEGA: 17
Homologene: 136357
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
9030624G23Rik
Name: RIKEN cDNA 9030624G23 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66808
VEGA: 12
Homologene: 136548
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 66,677,385 bp
  • G to T, chromosome 1 at 136,069,018 bp
  • G to A, chromosome 1 at 160,114,685 bp
  • G to A, chromosome 2 at 30,090,584 bp
  • T to C, chromosome 2 at 32,992,257 bp
  • A to T, chromosome 2 at 68,728,995 bp
  • A to T, chromosome 2 at 86,754,093 bp
  • T to A, chromosome 2 at 152,933,108 bp
  • A to G, chromosome 3 at 83,128,057 bp
  • A to G, chromosome 3 at 142,794,107 bp
  • C to T, chromosome 4 at 73,919,862 bp
  • A to G, chromosome 4 at 155,856,239 bp
  • T to G, chromosome 6 at 40,668,193 bp
  • C to T, chromosome 6 at 71,941,512 bp
  • T to C, chromosome 6 at 96,115,756 bp
  • C to A, chromosome 6 at 134,869,392 bp
  • G to A, chromosome 7 at 25,288,782 bp
  • A to T, chromosome 7 at 28,403,903 bp
  • T to C, chromosome 7 at 72,185,796 bp
  • A to T, chromosome 7 at 110,441,426 bp
  • A to G, chromosome 7 at 141,862,239 bp
  • C to T, chromosome 8 at 18,692,064 bp
  • G to A, chromosome 8 at 44,951,633 bp
  • T to C, chromosome 10 at 80,058,874 bp
  • T to C, chromosome 10 at 120,095,102 bp
  • T to C, chromosome 11 at 5,687,451 bp
  • A to G, chromosome 11 at 29,173,352 bp
  • A to T, chromosome 11 at 32,248,150 bp
  • T to G, chromosome 12 at 24,074,673 bp
  • G to T, chromosome 12 at 85,279,058 bp
  • A to T, chromosome 13 at 33,397,858 bp
  • T to C, chromosome 13 at 34,639,063 bp
  • A to G, chromosome 13 at 53,117,225 bp
  • C to T, chromosome 13 at 104,217,206 bp
  • T to C, chromosome 15 at 83,541,334 bp
  • G to A, chromosome 15 at 88,964,170 bp
  • A to G, chromosome 16 at 56,825,737 bp
  • G to A, chromosome 16 at 87,729,633 bp
  • G to T, chromosome 17 at 17,538,562 bp
  • T to C, chromosome 17 at 25,836,193 bp
  • C to T, chromosome 17 at 38,335,394 bp
  • C to T, chromosome 17 at 40,578,829 bp
  • C to T, chromosome 17 at 57,218,859 bp
  • T to C, chromosome 17 at 78,677,372 bp
  • G to C, chromosome 17 at 80,347,120 bp
  • T to A, chromosome 18 at 31,444,265 bp
  • CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC, chromosome 18 at 75,471,803 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7746 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045802-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.