Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7755Btlr/Mmmh
Stock Number:
045811-MU
Citation ID:
RRID:MMRRC_045811-MU
Other Names:
R7755 (G1)
Major Collection:

Strain Information

Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Sirt3
Name: sirtuin 3
Synonyms: Sir2l3, 2310003L23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64384
Homologene: 81827
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Mbd4
Name: methyl-CpG binding domain protein 4
Synonyms: Med1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17193
HGNC: HGNC:6919
Homologene: 2916
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Pparg
Name: peroxisome proliferator activated receptor gamma
Synonyms: Nr1c3, PPAR-gamma, Ppar-gamma2, PPARgamma, PPARgamma2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19016
HGNC: HGNC:9236
Homologene: 7899
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Rcad, Maxer, 1810074P20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67490
Homologene: 9093
Aff4
Name: AF4/FMR2 family, member 4
Synonyms: Alf4, Laf4l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93736
Homologene: 8683
Ticam1
Name: TIR domain containing adaptor molecule 1
Synonyms: Trif, TICAM-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106759
Homologene: 8605
Shld2
Name: shieldin complex subunit 2
Synonyms: 3110001K24Rik, Fam35a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75698
VEGA: 14
Homologene: 56840
Neto2
Name: neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms: 5530601C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74513
Homologene: 32387
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Tnrc6c
Name: trinucleotide repeat containing 6C
Synonyms: 9930033H14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217351
Homologene: 23137
Nsl1
Name: NSL1, MIS12 kinetochore complex component
Synonyms: LOC381318, 4833432M17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381318
Homologene: 22898
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Cngb3
Name: cyclic nucleotide gated channel beta 3
Synonyms: CNG6, CCNC2, Cngbeta2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30952
HGNC: HGNC:2153
Homologene: 40908
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Or8b54
Name: olfactory receptor family 8 subfamily B member 54
Synonyms: GA_x6K02T2PVTD-32478047-32478988, MOR165-8, Olfr921
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258778
VEGA: 9
Homologene: 128138
Vmn2r88
Name: vomeronasal 2, receptor 88
Synonyms: V2r13, V2r3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 669149
Homologene: 129606
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Slc22a30
Name: solute carrier family 22, member 30
Synonyms: C730048C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 319800
Homologene: 77136
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Dmrta1
Name: doublesex and mab-3 related transcription factor like family A1
Synonyms: Dmrt4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242523
Homologene: 18477
Ctsll3
Name: cathepsin L-like 3
Synonyms: 2310051M13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70202
VEGA: 13
Homologene: 134916
Or2w25
Name: olfactory receptor family 2 subfamily W member 25
Synonyms: GA_x6K02T0073K-490-1545, MOR256-51, Olfr225
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257886
Homologene: 105324
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Dsbc1, Rcr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Usp43
Name: ubiquitin specific peptidase 43
Synonyms: C630032K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216835
Homologene: 129879
Ndufb9
Name: NADH:ubiquinone oxidoreductase subunit B9
Synonyms: 1190008J14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66218
VEGA: 15
HGNC: HGNC:7704
Homologene: 3669
Ivl
Name: involucrin
Synonyms: 1110019C06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16447
HGNC: HGNC:6187
Homologene: 137207
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Flot2
Name: flotillin 2
Synonyms: Esa, reggie-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14252
HGNC: HGNC:3758
Homologene: 3293
Begain
Name: brain-enriched guanylate kinase-associated
Synonyms: LOC380785
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380785
Homologene: 10829
Carf
Name: calcium response factor
Synonyms: Als2cr8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241066
Homologene: 11689
Slc40a1
Name: solute carrier family 40 (iron-regulated transporter), member 1
Synonyms: Ol5, ferroportin1, IREG1, FPN1, metal transporting protein 1, MTP1, Slc11a3, Dusg, Pcm
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53945
Homologene: 40959
Mlip
Name: muscular LMNA-interacting protein
Synonyms: 2310046A06Rik, cardiac ISL1-interacting protein, CIP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69642
Homologene: 90445
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Slc6a17
Name: solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms: D130012J15Rik, NTT4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229706
Homologene: 27775
Poglut2
Name: protein O-glucosyltransferase 2
Synonyms: EP58, 1810049A15Rik, 5730416C13Rik, Kdel1, Kdelc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72050
Homologene: 11367
Rangrf
Name: RAN guanine nucleotide release factor
Synonyms: Mog1, Rangnrf, 2400006H24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57785
Homologene: 41138
Zfp128
Name: zinc finger protein 128
Synonyms: mZnf8, 9630016P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243833
Homologene: 10889
Mrgprf
Name: MAS-related GPR, member F
Synonyms: MrgF
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211577
Homologene: 17023
Nudt21
Name: nudix hydrolase 21
Synonyms: 3110048P04Rik, 25kDa, 5730530J16Rik, Cpsf5, nudix (nucleoside diphosphate linked moiety X)-type motif 21
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68219
Homologene: 5090
Ppargc1a
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
Synonyms: Pgc1, PPAR Gamma Coactivator-1, Pgco1, Pgc-1alpha, Pgc-1alphaa, A830037N07Rik, Gm11133
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19017
HGNC: HGNC:9237
Homologene: 7485
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,547,493 bp
  • T to C, chromosome 1 at 44,118,573 bp
  • T to C, chromosome 1 at 45,911,306 bp
  • T to A, chromosome 1 at 60,148,055 bp
  • G to A, chromosome 1 at 191,063,183 bp
  • G to A, chromosome 2 at 13,280,078 bp
  • T to C, chromosome 2 at 35,376,337 bp
  • T to C, chromosome 2 at 67,515,182 bp
  • T to C, chromosome 2 at 84,872,463 bp
  • T to C, chromosome 3 at 49,754,829 bp
  • T to A, chromosome 3 at 92,572,010 bp
  • C to T, chromosome 3 at 107,474,355 bp
  • A to T, chromosome 4 at 19,461,684 bp
  • A to G, chromosome 4 at 25,262,274 bp
  • T to C, chromosome 4 at 56,774,552 bp
  • T to C, chromosome 4 at 65,794,558 bp
  • T to C, chromosome 4 at 89,691,933 bp
  • T to A, chromosome 5 at 51,473,541 bp
  • TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG to TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG, chromosome 5 at 104,178,361 bp
  • C to T, chromosome 6 at 115,463,106 bp
  • T to A, chromosome 6 at 115,844,585 bp
  • C to T, chromosome 7 at 12,890,313 bp
  • T to C, chromosome 7 at 140,878,050 bp
  • T to C, chromosome 7 at 145,308,643 bp
  • C to T, chromosome 8 at 85,669,656 bp
  • T to A, chromosome 8 at 94,022,865 bp
  • A to G, chromosome 8 at 109,630,166 bp
  • T to C, chromosome 9 at 7,015,490 bp
  • T to A, chromosome 9 at 7,467,004 bp
  • T to G, chromosome 9 at 38,775,777 bp
  • T to A, chromosome 9 at 53,559,170 bp
  • T to C, chromosome 9 at 77,229,556 bp
  • T to C, chromosome 11 at 53,398,379 bp
  • A to G, chromosome 11 at 59,613,641 bp
  • A to T, chromosome 11 at 67,891,468 bp
  • T to A, chromosome 11 at 68,973,714 bp
  • T to C, chromosome 11 at 78,049,513 bp
  • T to C, chromosome 11 at 98,028,367 bp
  • A to G, chromosome 11 at 117,758,086 bp
  • A to T, chromosome 12 at 51,802,220 bp
  • G to A, chromosome 12 at 71,189,413 bp
  • A to T, chromosome 12 at 75,997,407 bp
  • A to G, chromosome 12 at 109,052,876 bp
  • A to T, chromosome 13 at 60,800,405 bp
  • T to C, chromosome 14 at 34,248,890 bp
  • C to G, chromosome 14 at 51,413,046 bp
  • A to G, chromosome 14 at 55,887,968 bp
  • T to G, chromosome 15 at 58,936,406 bp
  • C to T, chromosome 17 at 3,421,316 bp
  • C to T, chromosome 17 at 15,544,964 bp
  • A to T, chromosome 17 at 18,110,049 bp
  • T to C, chromosome 17 at 18,424,105 bp
  • A to G, chromosome 17 at 56,270,182 bp
  • T to C, chromosome 19 at 8,336,769 bp
  • G to A, chromosome 19 at 43,850,086 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7755 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045811-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.