Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7755Btlr/Mmmh
Stock Number:
045811-MU
Citation ID:
RRID:MMRRC_045811-MU
Other Names:
R7755 (G1)
Major Collection:

Strain Information

Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Sirt3
Name: sirtuin 3
Synonyms: Sir2l3, 2310003L23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64384
Homologene: 81827
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Mbd4
Name: methyl-CpG binding domain protein 4
Synonyms: Med1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17193
HGNC: HGNC:6919
Homologene: 2916
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,547,493 bp
  • T to C, chromosome 1 at 44,118,573 bp
  • T to C, chromosome 1 at 45,911,306 bp
  • T to A, chromosome 1 at 60,148,055 bp
  • G to A, chromosome 1 at 191,063,183 bp
  • G to A, chromosome 2 at 13,280,078 bp
  • T to C, chromosome 2 at 35,376,337 bp
  • T to C, chromosome 2 at 67,515,182 bp
  • T to C, chromosome 2 at 84,872,463 bp
  • T to C, chromosome 3 at 49,754,829 bp
  • T to A, chromosome 3 at 92,572,010 bp
  • C to T, chromosome 3 at 107,474,355 bp
  • A to T, chromosome 4 at 19,461,684 bp
  • A to G, chromosome 4 at 25,262,274 bp
  • T to C, chromosome 4 at 56,774,552 bp
  • T to C, chromosome 4 at 65,794,558 bp
  • T to C, chromosome 4 at 89,691,933 bp
  • T to A, chromosome 5 at 51,473,541 bp
  • TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG to TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG, chromosome 5 at 104,178,361 bp
  • C to T, chromosome 6 at 115,463,106 bp
  • T to A, chromosome 6 at 115,844,585 bp
  • C to T, chromosome 7 at 12,890,313 bp
  • T to C, chromosome 7 at 140,878,050 bp
  • T to C, chromosome 7 at 145,308,643 bp
  • C to T, chromosome 8 at 85,669,656 bp
  • T to A, chromosome 8 at 94,022,865 bp
  • A to G, chromosome 8 at 109,630,166 bp
  • T to C, chromosome 9 at 7,015,490 bp
  • T to A, chromosome 9 at 7,467,004 bp
  • T to G, chromosome 9 at 38,775,777 bp
  • T to A, chromosome 9 at 53,559,170 bp
  • T to C, chromosome 9 at 77,229,556 bp
  • T to C, chromosome 11 at 53,398,379 bp
  • A to G, chromosome 11 at 59,613,641 bp
  • A to T, chromosome 11 at 67,891,468 bp
  • T to A, chromosome 11 at 68,973,714 bp
  • T to C, chromosome 11 at 78,049,513 bp
  • T to C, chromosome 11 at 98,028,367 bp
  • A to G, chromosome 11 at 117,758,086 bp
  • A to T, chromosome 12 at 51,802,220 bp
  • G to A, chromosome 12 at 71,189,413 bp
  • A to T, chromosome 12 at 75,997,407 bp
  • A to G, chromosome 12 at 109,052,876 bp
  • A to T, chromosome 13 at 60,800,405 bp
  • T to C, chromosome 14 at 34,248,890 bp
  • C to G, chromosome 14 at 51,413,046 bp
  • A to G, chromosome 14 at 55,887,968 bp
  • T to G, chromosome 15 at 58,936,406 bp
  • C to T, chromosome 17 at 3,421,316 bp
  • C to T, chromosome 17 at 15,544,964 bp
  • A to T, chromosome 17 at 18,110,049 bp
  • T to C, chromosome 17 at 18,424,105 bp
  • A to G, chromosome 17 at 56,270,182 bp
  • T to C, chromosome 19 at 8,336,769 bp
  • G to A, chromosome 19 at 43,850,086 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7755 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045811-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.