Strain Name:
C57BL/6J-MtgxR7826Btlr/Mmmh
Stock Number:
045880-MU
Citation ID:
RRID:MMRRC_045880-MU
Other Names:
R7826 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: C030030P04Rik, Acrb-2, [b]2-nAchR, Acrb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Spats1
Name: spermatogenesis associated, serine-rich 1
Synonyms: Srsp1, 1700011H05Rik, 4933400B06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71020
VEGA: 17
Homologene: 12376
Slc6a4
Name: solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms: Htt, Sert, 5-HTT
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15567
Homologene: 817
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: Qprs, 2410081F06Rik, 3010002K18Rik, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Ranbp9
Name: RAN binding protein 9
Synonyms: RanBPM, IBAP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235469
Homologene: 17151
Spcs2
Name: signal peptidase complex subunit 2 homolog (S. cerevisiae)
Synonyms: 5730406I15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66624
Homologene: 8842
Btbd9
Name: BTB domain containing 9
Synonyms: 1700023F20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224671
VEGA: 17
Homologene: 14995
Tango6
Name: transport and golgi organization 6
Synonyms: Tango6, Tmco7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Nudcd3
Name: NudC domain containing 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209586
Homologene: 9097
Rsf1
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, XAP8, Hbxap, C030033M12Rik, p325
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Epha8
Name: Eph receptor A8
Synonyms: Eek, EphA8, Hek3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66887
Homologene: 12050
Nf2
Name: neurofibromin 2
Synonyms: moesin-ezrin-radixin-like protein, merlin, schwannomin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18016
HGNC: HGNC:7773
Homologene: 2180
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, Rpo1-2, RPA116, D630020H17Rik, 128kDa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: LOC380777, skNAC
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Uty
Name: ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
Synonyms: Hydb
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22290
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Igsf9
Name: immunoglobulin superfamily, member 9
Synonyms: NRT1, Dasm1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93842
Homologene: 10815
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: Girdin, C330012F17Rik, HkRP1, C130096N06Rik, D130005J21Rik, GIV, A430106J12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
Phactr4
Name: phosphatase and actin regulator 4
Synonyms: 3110001B12Rik, C330013F19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100169
Homologene: 41537
Pcdhb18
Name: protocadherin beta 18
Synonyms: PcdhbR, Pcdhb9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Man1a2
Name: mannosidase, alpha, class 1A, member 2
Synonyms: Man1b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17156
HGNC: HGNC:6822
Homologene: 55982
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b3491Clo, Mdnah5, b2b1537Clo, b2b1134Clo, Dnahc5, b2b1154Clo, b2b1565Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Mrc1
Name: mannose receptor, C type 1
Synonyms: MR, CD206
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Dlgap2
Name: DLG associated protein 2
Synonyms: PSD-95/SAP90-binding protein 2, 6430596N04Rik, DAP2, SAP90/PSD-95-associated protein 2, Sapap2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244310
HGNC: HGNC:2906
Homologene: 3484
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Npas3
Name: neuronal PAS domain protein 3
Synonyms: 4930423H22Rik, bHLHe12
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27386
VEGA: 12
Homologene: 8461
Gpr75
Name: G protein-coupled receptor 75
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237716
HGNC: HGNC:4526
Homologene: 4945
Or8g33
Name: olfactory receptor family 8 subfamily G member 33
Synonyms: GA_x6K02T2PVTD-33124064-33123120, MOR171-21, Olfr952
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235248
VEGA: 9
Homologene: 133698
Ccdc27
Name: coiled-coil domain containing 27
Synonyms: LOC381580
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381580
Homologene: 17596
Tmem145
Name: transmembrane protein 145
Synonyms: B930076A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330485
Homologene: 18333
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, Pappe, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243274
Homologene: 71684
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Sptlc3
Name: serine palmitoyltransferase, long chain base subunit 3
Synonyms: C130053K05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228677
Homologene: 105590
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Triml1
Name: tripartite motif family-like 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244448
Homologene: 18619
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Fbxw5
Name: F-box and WD-40 domain protein 5
Synonyms: Fbw5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30839
Homologene: 8496
Ajm1
Name: apical junction component 1
Synonyms: LOC381353, Gm996
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381353
Homologene: 19943
Donson
Name: downstream neighbor of SON
Synonyms: ORF60, Donson, 1110025J21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 60364
HGNC: HGNC:2993
Homologene: 32350
Mipep
Name: mitochondrial intermediate peptidase
Synonyms: 5730405E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70478
VEGA: 14
HGNC: HGNC:7104
Homologene: 4337
Arhgap27
Name: Rho GTPase activating protein 27
Synonyms: Sh3d20, 5730442P18Rik, 2310069I04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544817
Homologene: 45715
Tbc1d30
Name: TBC1 domain family, member 30
Synonyms: 4930505D03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74694
VEGA: 10
Homologene: 18930
Cd300c2
Name: CD300C molecule 2
Synonyms: LMIR2, AF251705, Clm4, Cd300d, DIgR1, Igsf7, MAIR-II
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140497
Homologene: 74580
Smpd5
Name: sphingomyelin phosphodiesterase 5
Synonyms: Gm10345
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 100503915
Homologene: 132205
Echs1
Name: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 93747
HGNC: HGNC:3151
Homologene: 3018
Zfand2b
Name: zinc finger, AN1 type domain 2B
Synonyms: 1110060O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68818
Homologene: 32671
Gm5160
Name: predicted gene 5160
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 382096
VEGA: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,168,858 bp
  • A to T, chromosome 1 at 158,936,440 bp
  • T to C, chromosome 1 at 172,491,630 bp
  • T to G, chromosome 1 at 185,406,968 bp
  • T to A, chromosome 2 at 14,294,857 bp
  • C to A, chromosome 2 at 25,502,549 bp
  • C to A, chromosome 2 at 25,578,465 bp
  • T to G, chromosome 2 at 76,884,876 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • T to C, chromosome 2 at 139,547,195 bp
  • A to T, chromosome 3 at 89,763,243 bp
  • T to C, chromosome 3 at 100,582,139 bp
  • T to C, chromosome 4 at 132,378,441 bp
  • C to T, chromosome 4 at 136,936,187 bp
  • A to G, chromosome 4 at 148,055,010 bp
  • C to T, chromosome 4 at 154,039,501 bp
  • A to G, chromosome 5 at 127,789,889 bp
  • G to T, chromosome 6 at 77,244,112 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • T to C, chromosome 6 at 128,487,533 bp
  • T to C, chromosome 7 at 7,182,669 bp
  • T to C, chromosome 7 at 25,307,514 bp
  • T to C, chromosome 7 at 67,735,589 bp
  • A to G, chromosome 7 at 97,661,161 bp
  • C to T, chromosome 7 at 99,839,777 bp
  • T to A, chromosome 7 at 140,116,436 bp
  • C to T, chromosome 8 at 14,743,410 bp
  • A to T, chromosome 8 at 43,138,766 bp
  • C to T, chromosome 8 at 86,709,013 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • A to G, chromosome 8 at 106,692,613 bp
  • A to G, chromosome 9 at 39,426,127 bp
  • C to A, chromosome 9 at 72,312,671 bp
  • C to T, chromosome 10 at 12,401,306 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • A to T, chromosome 10 at 121,296,805 bp
  • T to A, chromosome 10 at 128,043,610 bp
  • T to C, chromosome 11 at 4,789,750 bp
  • T to A, chromosome 11 at 6,150,581 bp
  • A to T, chromosome 11 at 29,503,563 bp
  • A to G, chromosome 11 at 30,891,209 bp
  • A to T, chromosome 11 at 77,013,025 bp
  • T to C, chromosome 11 at 103,338,327 bp
  • C to T, chromosome 11 at 115,000,818 bp
  • A to G, chromosome 12 at 53,831,756 bp
  • T to C, chromosome 13 at 43,419,621 bp
  • G to A, chromosome 14 at 14,860,846 bp
  • C to A, chromosome 14 at 60,802,131 bp
  • C to T, chromosome 15 at 28,367,812 bp
  • T to C, chromosome 15 at 76,296,296 bp
  • T to C, chromosome 16 at 91,688,456 bp
  • A to T, chromosome 17 at 30,334,327 bp
  • C to T, chromosome 17 at 45,452,718 bp
  • C to T, chromosome 18 at 14,425,072 bp
  • T to A, chromosome 18 at 37,490,942 bp
  • T to C, chromosome Y at 1,137,716 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7826 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045880-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.