Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7844Btlr/Mmmh
Stock Number:
045898-MU
Citation ID:
RRID:MMRRC_045898-MU
Other Names:
R7844 (G1)
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Gabrg1
Name: gamma-aminobutyric acid type A receptor subunit gamma 1
Synonyms: GabaA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14405
HGNC: HGNC:4086
Homologene: 22570
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-3, Pk-2, Pk3, Pkm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 79,816,799 bp
  • A to G, chromosome 1 at 134,203,538 bp
  • A to G, chromosome 1 at 135,394,324 bp
  • A to G, chromosome 2 at 19,254,018 bp
  • A to C, chromosome 2 at 155,292,720 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • T to G, chromosome 3 at 30,009,824 bp
  • A to T, chromosome 3 at 59,729,897 bp
  • G to T, chromosome 3 at 142,536,386 bp
  • T to C, chromosome 4 at 88,868,186 bp
  • C to A, chromosome 4 at 154,989,465 bp
  • A to T, chromosome 5 at 35,607,148 bp
  • T to C, chromosome 5 at 70,774,332 bp
  • T to A, chromosome 5 at 104,018,266 bp
  • T to C, chromosome 5 at 107,874,994 bp
  • C to A, chromosome 5 at 137,071,189 bp
  • T to C, chromosome 5 at 137,332,186 bp
  • C to T, chromosome 6 at 113,370,960 bp
  • A to T, chromosome 7 at 3,719,411 bp
  • A to T, chromosome 7 at 26,562,581 bp
  • A to C, chromosome 7 at 41,040,698 bp
  • T to G, chromosome 7 at 104,106,483 bp
  • G to A, chromosome 7 at 114,030,332 bp
  • A to G, chromosome 8 at 4,269,976 bp
  • G to T, chromosome 8 at 11,425,453 bp
  • A to T, chromosome 8 at 11,656,174 bp
  • A to G, chromosome 8 at 12,851,039 bp
  • G to A, chromosome 8 at 81,741,320 bp
  • A to G, chromosome 8 at 107,358,668 bp
  • A to T, chromosome 9 at 55,815,448 bp
  • A to G, chromosome 9 at 59,670,722 bp
  • A to G, chromosome 9 at 65,045,667 bp
  • A to T, chromosome 10 at 26,078,357 bp
  • T to C, chromosome 10 at 52,339,749 bp
  • C to T, chromosome 10 at 61,702,165 bp
  • A to G, chromosome 10 at 77,923,506 bp
  • T to C, chromosome 10 at 92,902,058 bp
  • A to G, chromosome 10 at 127,350,910 bp
  • A to T, chromosome 11 at 34,813,343 bp
  • C to A, chromosome 11 at 107,074,061 bp
  • A to G, chromosome 12 at 30,100,405 bp
  • T to A, chromosome 12 at 69,302,406 bp
  • C to A, chromosome 12 at 82,397,493 bp
  • T to G, chromosome 12 at 101,878,144 bp
  • G to A, chromosome 12 at 105,176,556 bp
  • A to G, chromosome 12 at 111,997,952 bp
  • A to G, chromosome 13 at 38,209,989 bp
  • A to G, chromosome 13 at 73,938,533 bp
  • A to C, chromosome 14 at 8,039,792 bp
  • T to C, chromosome 15 at 23,410,787 bp
  • G to A, chromosome 15 at 101,412,634 bp
  • A to T, chromosome 16 at 58,718,510 bp
  • G to A, chromosome 17 at 74,404,093 bp
  • A to T, chromosome 17 at 84,673,590 bp
  • T to G, chromosome 18 at 10,104,173 bp
  • T to C, chromosome 18 at 84,014,171 bp
  • C to T, chromosome 19 at 6,055,170 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7844 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045898-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.