Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7902Btlr/Mmmh
Stock Number:
045954-MU
Citation ID:
RRID:MMRRC_045954-MU
Other Names:
R7902 (G1)
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Gapdhs
Name: glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Synonyms: Gapd-s, Gapds
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14447
Homologene: 101265
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: Taf2c1, TAFII135, TAFII130, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Foxk2
Name: forkhead box K2
Synonyms: 5730434B08Rik, 1110054H05Rik, Ilf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68837
HGNC: HGNC:6036
Homologene: 18748
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Zfp12
Name: zinc finger protein 12
Synonyms: Krox-7, Zfp-12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231866
Homologene: 65328
H1f3
Name: H1.3 linker histone, cluster member
Synonyms: H1.3, H1D, H1s-4, H1f3, Hist1h1d
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14957
HGNC: HGNC:4717
Homologene: 68456
Zfp933
Name: zinc finger protein 933
Synonyms: 2810408P10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242747
Homologene: 138474
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Nlrp4a
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Fyb1
Name: FYN binding protein 1
Synonyms: FYB-120/130, ADAP, B630013F22Rik, Fyb
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23880
HGNC: HGNC:4036
Homologene: 22664
Oat
Name: ornithine aminotransferase
Synonyms: rhg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18242
HGNC: HGNC:8091
Homologene: 231
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Plpp2
Name: phospholipid phosphatase 2
Synonyms: Lpp2, Ppap2c
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 50784
HGNC: HGNC:9230
Homologene: 2752
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Edem1
Name: ER degradation enhancer, mannosidase alpha-like 1
Synonyms: A130059K23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 192193
Homologene: 33836
Defb26
Name: defensin beta 26
Synonyms: EG654457
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 654457
Homologene: 86850
F13a1
Name: coagulation factor XIII, A1 subunit
Synonyms: Factor XIIIA, 1200014I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74145
VEGA: 13
HGNC: HGNC:3531
Homologene: 20077
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Vmn2r120
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224916
Hddc2
Name: HD domain containing 2
Synonyms: 2310057G13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69692
Homologene: 5431
Sgf29
Name: SAGA complex associated factor 29
Synonyms: 1700023O11Rik, Ccdc101
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75565
Homologene: 12607
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Zfp937
Name: zinc finger protein 937
Synonyms: Gm4979
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245174
Homologene: 136215
Klk10
Name: kallikrein related-peptidase 10
Synonyms: PRSSL1, NES1, 2300002A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69540
HGNC: HGNC:6358
Homologene: 26428
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Rps6ka4
Name: ribosomal protein S6 kinase, polypeptide 4
Synonyms: MSK2, 1110069D02Rik, 90kDa
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56613
VEGA: 19
Homologene: 69288
A530084C06Rik
Name: RIKEN cDNA A530084C06 gene
Type: Gene
Species: Mouse
Chromosome: 13
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: TS14, Adamts-14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Vmn1r158
Name: vomeronasal 1 receptor 158
Synonyms: Gm16455
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043067
Homologene: 104166
Lin7a
Name: lin-7 homolog A, crumbs cell polarity complex component
Synonyms: LIN-7A, TIP-33, MALS-1, Veli
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108030
VEGA: 10
Homologene: 20976
Or52n2c
Name: olfactory receptor family 52 subfamily N member 2C
Synonyms: GA_x6K02T2PBJ9-7554614-7553658, MOR34-3, Olfr668
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259061
Homologene: 64947
Sars2
Name: seryl-aminoacyl-tRNA synthetase 2
Synonyms: 2410015F05Rik, D7Ertd353e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71984
Homologene: 6073
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 60,291,870 bp
  • A to T, chromosome 2 at 82,977,824 bp
  • A to T, chromosome 2 at 150,238,761 bp
  • A to T, chromosome 2 at 152,508,236 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • T to A, chromosome 4 at 147,826,601 bp
  • T to C, chromosome 5 at 142,772,147 bp
  • A to G, chromosome 5 at 143,245,780 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • C to T, chromosome 6 at 108,854,377 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 7 at 22,790,008 bp
  • T to A, chromosome 7 at 26,450,057 bp
  • T to C, chromosome 7 at 28,742,203 bp
  • T to C, chromosome 7 at 30,736,721 bp
  • T to A, chromosome 7 at 43,783,518 bp
  • A to G, chromosome 7 at 104,925,350 bp
  • C to T, chromosome 7 at 126,672,178 bp
  • C to T, chromosome 7 at 132,559,664 bp
  • A to G, chromosome 8 at 128,836,173 bp
  • T to A, chromosome 9 at 79,641,581 bp
  • T to C, chromosome 9 at 110,637,547 bp
  • A to T, chromosome 10 at 31,316,293 bp
  • T to A, chromosome 10 at 31,320,342 bp
  • T to C, chromosome 10 at 61,205,397 bp
  • A to T, chromosome 10 at 79,527,544 bp
  • T to C, chromosome 10 at 107,323,982 bp
  • G to A, chromosome 11 at 30,136,048 bp
  • A to G, chromosome 11 at 121,299,727 bp
  • T to C, chromosome 13 at 23,555,331 bp
  • G to T, chromosome 13 at 31,558,995 bp
  • C to A, chromosome 13 at 36,988,939 bp
  • A to G, chromosome 14 at 79,092,291 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to C, chromosome 15 at 6,660,716 bp
  • T to C, chromosome 15 at 55,501,436 bp
  • T to G, chromosome 15 at 73,568,115 bp
  • T to G, chromosome 17 at 57,509,244 bp
  • T to C, chromosome 19 at 6,831,311 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7902 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045954-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.