Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.
The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.
Embryo injections were done with one guide RNA. The target sequence for the guide RNA was GAAGTCACAGCACATGACGG (agg), which is located in exon 5 of Trp53. The following oligos were used to amplify the tetR DNA-binding domain (DBD) from the rtTA reverse tet transactivator (template plasmid from Hermann Bujard) for in-frame insertion into the DBD of p53:
Sense oligo: 5’- ccatgg ccatctacaa GAAGTCACAG CAC ATG Atg tct aga ctg gac aag agc aaa gtc
Antisense oligo: 5’- gctcatggtgggggcagcgtctcacgacctc cg C GCTTTCGCACTTTAGCTGTTTCTC
The CRISPR guide RNA, Cas9 mRNA, and donor DNA were microinjected into the cytoplasm of FVB zygotes. Progeny were screened by PCR using primers 821 (cagagaaacagtacgaaaccctg) and 826 (gagcaagaataagtcagaagcc) to look for targeted insertion of the rtTetR sequences. One founder male was mated to FVB females, and the F1 progeny were screened by PCR amplifications of tail DNA using primers 821+826, and primers 825 (cttgacacctgatcgttactcgg) +826 to amplify the entire tetR insertion. The PCR bands were sequenced.
Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/NOve.
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Colony Surveillance Program and Current Health Reports
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The submitter or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.