Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8228Btlr/Mmmh
Stock Number:
067661-MU
Citation ID:
RRID:MMRRC_067661-MU
Other Names:
R8228 (G1)
Major Collection:

Strain Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
Iffo2
Name: intermediate filament family orphan 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212632
Homologene: 102202
Alox12b
Name: arachidonate 12-lipoxygenase, 12R type
Synonyms: e-LOX2, Aloxe2, 12R-LOX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11686
HGNC: HGNC:430
Homologene: 884
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Kif15
Name: kinesin family member 15
Synonyms: N-10 kinesin, HKLP2, 3930402I10Rik, 3110023M17Rik, Knsl7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209737
VEGA: 9
Homologene: 23210
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Pcgf2
Name: polycomb group ring finger 2
Synonyms: Zfp144, mel-18, Rnf110, Mel18
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22658
Homologene: 5174
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Abcf1
Name: ATP-binding cassette, sub-family F member 1
Synonyms: Abc50, D17Wsu166e, GCN20
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224742
HGNC: HGNC:70
Homologene: 849
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Cert1
Name: ceramide transporter 1
Synonyms: 2810404O15Rik, GPBP, 9230101K08Rik, Cert, ceramide transport protein, Col4a3bp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68018
VEGA: 13
HGNC: HGNC:2205
Homologene: 4173
Tsc1
Name: TSC complex subunit 1
Synonyms: hamartin, tuberous sclerosis 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64930
Homologene: 314
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Csdc2
Name: cold shock domain containing C2, RNA binding
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105859
Homologene: 8701
Atp2b4
Name: ATPase, Ca++ transporting, plasma membrane 4
Synonyms: PMCA4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381290
HGNC: HGNC:817
Homologene: 48034
Sec24c
Name: SEC24 homolog C, COPII coat complex component
Synonyms: 2610204K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218811
VEGA: 14
Homologene: 3615
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502846
Homologene: 132117
Sdr9c7
Name: 4short chain dehydrogenase/reductase family 9C, member 7
Synonyms: SDR-O, Rdhs, 1810054F20Rik, Sdro, Rdh20
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70061
Homologene: 23618
Zc3h7a
Name: zinc finger CCCH type containing 7 A
Synonyms: A430104C18Rik, Zc3h7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106205
Homologene: 8563
Grik5
Name: glutamate receptor, ionotropic, kainate 5 (gamma 2)
Synonyms: KA2, GluRgamma2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14809
HGNC: HGNC:4583
Homologene: 1578
Trim46
Name: tripartite motif-containing 46
Synonyms: TRIFIC
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 360213
Homologene: 11815
Lrit2
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Synonyms: A930010E21Rik, Lrrc22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239038
VEGA: 14
Homologene: 18292
Mmut
Name: methylmalonyl-Coenzyme A mutase
Synonyms: D230010K02Rik, Mut
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17850
VEGA: 17
HGNC: HGNC:7526
Homologene: 20097
Or5w8
Name: olfactory receptor family 5 subfamily W member 8
Synonyms: GA_x6K02T2Q125-49358694-49359620, MOR177-9, Olfr1151
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258631
Homologene: 36999
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Cfap119
Name: cilia and flagella associated protein 119
Synonyms: LOC233899, Gm166, Ccdc189
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233899
Homologene: 79950
Mcm8
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66634
Homologene: 12001
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Usp36
Name: ubiquitin specific peptidase 36
Synonyms: 2700002L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72344
Homologene: 11828
Or4n4
Name: olfactory receptor family 4 subfamily N member 4
Synonyms: GA_x6K02T2PMLR-5975274-5974348, MOR241-1, Olfr732
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258659
Homologene: 72012
Zfp456
Name: zinc finger protein 456
Synonyms: Rslcan-13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408065
Homologene: 110878
4930438A08Rik
Name: RIKEN cDNA 4930438A08 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73988
Homologene: 104884
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Gjb6
Name: gap junction protein, beta 6
Synonyms: connexin 30, Cx30, D14Bwg0506e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14623
HGNC: HGNC:4288
Homologene: 4936
1700008O03Rik
Name: RIKEN cDNA 1700008O03 gene
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69349
Homologene: 19260
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
0610030E20Rik
Name: RIKEN cDNA 0610030E20 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68364
Homologene: 19243
A930011G23Rik
Name: RIKEN cDNA A930011G23 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319818
VEGA: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TTCTTC to TTCTTCCTCTTC, chromosome 1 at 133,701,721 bp
  • C to A, chromosome 2 at 28,676,129 bp
  • T to A, chromosome 2 at 87,857,940 bp
  • T to A, chromosome 2 at 128,619,917 bp
  • T to C, chromosome 2 at 132,842,794 bp
  • G to A, chromosome 2 at 164,904,898 bp
  • G to T, chromosome 3 at 89,234,948 bp
  • C to G, chromosome 4 at 139,575,172 bp
  • G to A, chromosome 5 at 99,377,121 bp
  • T to C, chromosome 6 at 72,347,517 bp
  • T to C, chromosome 7 at 25,010,508 bp
  • A to T, chromosome 7 at 25,046,310 bp
  • T to C, chromosome 7 at 41,376,836 bp
  • A to G, chromosome 7 at 44,360,305 bp
  • G to A, chromosome 7 at 127,585,007 bp
  • A to G, chromosome 8 at 35,785,838 bp
  • G to A, chromosome 8 at 69,798,919 bp
  • A to T, chromosome 8 at 117,065,775 bp
  • T to C, chromosome 9 at 107,961,066 bp
  • A to G, chromosome 9 at 122,991,976 bp
  • T to C, chromosome 10 at 33,157,018 bp
  • T to A, chromosome 10 at 68,278,706 bp
  • T to C, chromosome 10 at 127,898,675 bp
  • T to A, chromosome 11 at 58,291,555 bp
  • T to C, chromosome 11 at 69,163,929 bp
  • T to G, chromosome 11 at 94,945,600 bp
  • T to C, chromosome 11 at 97,692,039 bp
  • T to C, chromosome 11 at 106,567,171 bp
  • T to C, chromosome 11 at 118,264,890 bp
  • C to A, chromosome 13 at 67,366,414 bp
  • A to G, chromosome 13 at 96,543,215 bp
  • T to C, chromosome 14 at 14,116,843 bp
  • G to T, chromosome 14 at 20,689,907 bp
  • G to A, chromosome 14 at 37,069,191 bp
  • A to G, chromosome 14 at 50,281,540 bp
  • T to C, chromosome 14 at 57,124,469 bp
  • G to T, chromosome 15 at 66,639,940 bp
  • C to T, chromosome 15 at 81,949,210 bp
  • A to G, chromosome 16 at 11,139,090 bp
  • A to G, chromosome 16 at 73,012,880 bp
  • C to T, chromosome 17 at 19,591,022 bp
  • A to G, chromosome 17 at 35,961,041 bp
  • A to G, chromosome 17 at 40,937,328 bp
  • A to T, chromosome 17 at 56,191,129 bp
  • A to G, chromosome 18 at 37,728,183 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG,TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8228 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067661-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.