Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8375Btlr/Mmmh
Stock Number:
067743-MU
Citation ID:
RRID:MMRRC_067743-MU
Other Names:
R8375 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, Sox10m1, ETR-b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Bpifb3
Name: BPI fold containing family B, member 3
Synonyms: Rya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 378700
Homologene: 18807
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Net1
Name: neuroepithelial cell transforming gene 1
Synonyms: mNET1, Net1 homolog, 9530071N24Rik, 0610025H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56349
VEGA: 13
Homologene: 4283
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,024,641 bp
  • A to G, chromosome 1 at 45,442,730 bp
  • A to G, chromosome 1 at 192,434,816 bp
  • T to A, chromosome 2 at 34,983,719 bp
  • A to T, chromosome 2 at 76,727,165 bp
  • A to T, chromosome 2 at 84,880,689 bp
  • C to T, chromosome 2 at 130,394,226 bp
  • A to T, chromosome 2 at 153,925,795 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • G to A, chromosome 3 at 95,204,798 bp
  • T to C, chromosome 4 at 14,795,994 bp
  • A to G, chromosome 4 at 112,117,976 bp
  • A to T, chromosome 4 at 121,148,335 bp
  • T to C, chromosome 4 at 140,798,096 bp
  • T to C, chromosome 5 at 72,029,829 bp
  • C to A, chromosome 5 at 87,842,851 bp
  • C to T, chromosome 5 at 112,760,393 bp
  • C to T, chromosome 5 at 122,428,279 bp
  • A to C, chromosome 6 at 85,808,906 bp
  • A to T, chromosome 6 at 149,520,491 bp
  • A to T, chromosome 7 at 30,039,154 bp
  • T to G, chromosome 7 at 85,952,706 bp
  • T to A, chromosome 7 at 105,481,021 bp
  • T to C, chromosome 8 at 12,598,998 bp
  • C to T, chromosome 8 at 83,967,930 bp
  • A to G, chromosome 8 at 123,073,829 bp
  • T to C, chromosome 9 at 20,170,741 bp
  • G to C, chromosome 9 at 38,329,935 bp
  • T to A, chromosome 9 at 77,457,847 bp
  • T to A, chromosome 9 at 80,254,924 bp
  • A to G, chromosome 10 at 86,763,980 bp
  • C to A, chromosome 11 at 9,315,416 bp
  • A to T, chromosome 11 at 9,397,841 bp
  • T to C, chromosome 11 at 53,162,675 bp
  • G to A, chromosome 11 at 100,047,777 bp
  • G to T, chromosome 11 at 100,716,783 bp
  • T to C, chromosome 12 at 24,712,752 bp
  • G to T, chromosome 12 at 30,884,851 bp
  • A to T, chromosome 12 at 105,742,341 bp
  • A to G, chromosome 13 at 3,893,458 bp
  • T to G, chromosome 13 at 22,524,984 bp
  • A to G, chromosome 14 at 103,819,947 bp
  • A to T, chromosome 15 at 28,327,343 bp
  • A to T, chromosome 15 at 77,389,347 bp
  • A to T, chromosome 16 at 13,940,999 bp
  • A to G, chromosome 16 at 32,147,638 bp
  • C to T, chromosome 17 at 34,568,254 bp
  • T to A, chromosome 17 at 49,096,823 bp
  • T to C, chromosome 18 at 10,768,233 bp
  • T to C, chromosome 18 at 43,990,719 bp
  • G to A, chromosome 18 at 46,850,222 bp
  • C to A, chromosome 18 at 59,179,513 bp
  • T to C, chromosome 19 at 8,755,098 bp
  • G to T, chromosome 19 at 37,687,212 bp
  • A to T, chromosome 19 at 41,328,099 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8375 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067743-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.