Strain Name:
C57BL/6J-MtgxR8310Btlr/Mmmh
Stock Number:
067795-MU
Citation ID:
RRID:MMRRC_067795-MU
Other Names:
R8310 (G1)
Major Collection:

Strain Information

Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: BGT1, Gabt2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Ddx1
Name: DEAD box helicase 1
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104721
VEGA: 12
HGNC: HGNC:2734
Homologene: 3627
Tars2
Name: threonyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: Tarsl1, 2610024N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71807
Homologene: 23520
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Wdr7
Name: WD repeat domain 7
Synonyms: TRAG, TGF-beta resistance associated gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Mon2
Name: MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms: SF21, 2610528O22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67074
VEGA: 10
Homologene: 44309
Dyrk1a
Name: dual-specificity tyrosine phosphorylation regulated kinase 1a
Synonyms: Mnbh, 2310043O08Rik, D16Ertd493e, Dyrk, D16Ertd272e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13548
HGNC: HGNC:3091
Homologene: 55576
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: enaptin165, nesprin-1, A330049M09Rik, C130039F11Rik, SYNE-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Apob
Name: apolipoprotein B
Synonyms: apob-48, apob-100
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: D18Ertd139e, lcsd, D18Ertd723e, C85354, A430089E03Rik, nmf164
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Zfp868
Name: zinc finger protein 868
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234362
Homologene: 74376
Lrrtm3
Name: leucine rich repeat transmembrane neuronal 3
Synonyms: 9630044H04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216028
Homologene: 37110
Elavl1
Name: ELAV like RNA binding protein 1
Synonyms: HuR, ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R), Hua, W91709, 2410055N02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15568
HGNC: HGNC:3312
Homologene: 20367
Gm14325
Name: predicted gene 14325
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329575
Homologene: 134324
Agtr1a
Name: angiotensin II receptor, type 1a
Synonyms: AT1a, AT1, Agtr1a, Agtr-1a, Agt1ar, 1810074K20Rik, Angtr-1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11607
HGNC: HGNC:336
Homologene: 3556
Ppp2r5c
Name: protein phosphatase 2, regulatory subunit B', gamma
Synonyms: 2700063L20Rik, Band 8A, 2610043M05Rik, D12Bwg0916e, B56/PP2A gamma
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26931
VEGA: 12
HGNC: HGNC:9311
Homologene: 128665
Peg10
Name: paternally expressed 10
Synonyms: HB-1, Edr, MyEF-3 like, MEF3L, Mart2, Rtl2, MyEF-3, Mar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Nadk2
Name: NAD kinase 2, mitochondrial
Synonyms: 1110020G09Rik, Nadkd1, MNADK, 4933430B08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68646
Homologene: 14638
Emilin2
Name: elastin microfibril interfacer 2
Synonyms: FOAP-10, basilin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 246707
VEGA: 17
Homologene: 36483
Rnasel
Name: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms: E230029I04Rik, 2-5A-dependent RNAase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24014
Homologene: 8040
Stx18
Name: syntaxin 18
Synonyms: 4933425D03Rik, 1810035L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71116
Homologene: 9655
Slc36a2
Name: solute carrier family 36 (proton/amino acid symporter), member 2
Synonyms: Tramd1, PAT2, A530067G19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246049
Homologene: 72100
A830005F24Rik
Name: RIKEN cDNA A830005F24 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 442803
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, Cav1.1, muscle dysgenesis, DHPR alpha1s, mdg, sj, fmd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: Cytsb, 2810012G08Rik, B230396K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432572
Homologene: 45157
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: Myhse, MyHC-emb, Myhs-e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Ccdc146
Name: coiled-coil domain containing 146
Synonyms: 4930528G09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75172
Homologene: 67159
Zfp329
Name: zinc finger protein 329
Synonyms: 2810439M05Rik, 4632409L22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67230
Homologene: 23459
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330267
Homologene: 46582
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: EFA6C, 6330404E20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Slc35g2
Name: solute carrier family 35, member G2
Synonyms: Tmem22, LOC245020
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245020
Homologene: 11893
Or4e1
Name: olfactory receptor family 4 subfamily E member 1
Synonyms: Olfr1508, GA_x6K02T2RJGY-520647-521579, MOR244-2, MOR244-4, MOR10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57270
HGNC: HGNC:8296
Homologene: 10737
Gm4922
Name: predicted gene 4922
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237300
VEGA: 10
Homologene: 50497
Ybx2
Name: Y box protein 2
Synonyms: MSY2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53422
Homologene: 22942
Zbtb6
Name: zinc finger and BTB domain containing 6
Synonyms: Zfp482, A830092L04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241322
Homologene: 4829
Galnt1
Name: polypeptide N-acetylgalactosaminyltransferase 1
Synonyms: ppGaNTase-T1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14423
HGNC: HGNC:4123
Homologene: 8469
Vmn1r115
Name: vomeronasal 1 receptor 115
Synonyms: Gm8549
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667273
Homologene: 104166
Ccdc8
Name: coiled-coil domain containing 8
Synonyms: ENSMUSG00000041117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434130
Homologene: 49977
Babam1
Name: BRISC and BRCA1 A complex member 1
Synonyms: 5430437P03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68251
Homologene: 8574
Sox7
Name: SRY (sex determining region Y)-box 7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20680
VEGA: 14
Homologene: 7949
Cnot6l
Name: CCR4-NOT transcription complex, subunit 6-like
Synonyms: 4932442K20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231464
Homologene: 100830
Hsd17b2
Name: hydroxysteroid (17-beta) dehydrogenase 2
Synonyms: 17 HSD type 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15486
HGNC: HGNC:5211
Homologene: 99709
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194231
Homologene: 4604
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Semg1
Name: semenogelin 1
Synonyms: SVS II, semenoclotin, Svs2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53878
Homologene: 49325
Or5v1
Name: olfactory receptor family 5 subfamily V member 1
Synonyms: GA_x6K02T2PSCP-1956307-1957260, MOR249-2, Olfr110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258325
Homologene: 73968
Lce1l
Name: late cornified envelope 1L
Synonyms: 1110008K04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73730
Vmn1r57
Name: vomeronasal 1 receptor 57
Synonyms: Gm7519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665150
Homologene: 41799
Naa11
Name: N(alpha)-acetyltransferase 11, NatA catalytic subunit
Synonyms: Ard1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 97243
Homologene: 39206
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 136,087,337 bp
  • G to A, chromosome 1 at 153,754,988 bp
  • G to T, chromosome 2 at 37,429,884 bp
  • C to A, chromosome 2 at 164,238,171 bp
  • A to T, chromosome 2 at 177,831,799 bp
  • G to C, chromosome 3 at 92,850,459 bp
  • T to A, chromosome 3 at 95,750,959 bp
  • C to T, chromosome 3 at 154,704,949 bp
  • T to C, chromosome 4 at 134,229,419 bp
  • A to T, chromosome 5 at 21,301,471 bp
  • T to A, chromosome 5 at 38,128,039 bp
  • A to T, chromosome 5 at 96,091,676 bp
  • A to T, chromosome 5 at 97,391,878 bp
  • ACATCAGGATCC to ACATCAGGATCCCCATCAGGATCC, chromosome 6 at 4,756,454 bp
  • T to C, chromosome 6 at 12,396,613 bp
  • A to G, chromosome 6 at 121,363,291 bp
  • A to G, chromosome 7 at 5,221,025 bp
  • A to T, chromosome 7 at 12,810,189 bp
  • T to C, chromosome 7 at 16,995,401 bp
  • T to C, chromosome 7 at 20,844,894 bp
  • A to T, chromosome 8 at 4,301,786 bp
  • A to T, chromosome 8 at 69,613,795 bp
  • A to T, chromosome 8 at 70,852,805 bp
  • T to A, chromosome 8 at 71,397,985 bp
  • G to A, chromosome 8 at 117,742,416 bp
  • A to G, chromosome 9 at 100,552,788 bp
  • A to G, chromosome 10 at 5,347,829 bp
  • A to T, chromosome 10 at 18,783,788 bp
  • A to T, chromosome 10 at 64,089,708 bp
  • A to T, chromosome 10 at 107,777,600 bp
  • G to T, chromosome 10 at 123,002,783 bp
  • A to T, chromosome 11 at 9,378,269 bp
  • A to T, chromosome 11 at 55,179,332 bp
  • A to G, chromosome 11 at 62,132,345 bp
  • A to T, chromosome 11 at 67,096,007 bp
  • A to G, chromosome 11 at 69,940,368 bp
  • A to T, chromosome 12 at 8,009,033 bp
  • A to C, chromosome 12 at 13,224,279 bp
  • A to T, chromosome 12 at 110,545,825 bp
  • T to G, chromosome 13 at 30,381,762 bp
  • T to G, chromosome 13 at 48,514,251 bp
  • A to G, chromosome 14 at 52,463,823 bp
  • C to T, chromosome 14 at 63,943,826 bp
  • G to A, chromosome 15 at 9,103,332 bp
  • A to G, chromosome 16 at 17,354,048 bp
  • A to G, chromosome 16 at 94,691,791 bp
  • T to C, chromosome 17 at 37,499,257 bp
  • C to G, chromosome 17 at 71,255,146 bp
  • A to G, chromosome 17 at 84,773,096 bp
  • T to C, chromosome 18 at 12,193,398 bp
  • A to T, chromosome 18 at 24,271,629 bp
  • A to T, chromosome 18 at 35,979,713 bp
  • C to T, chromosome 18 at 63,735,685 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067795-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.