Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8310Btlr/Mmmh
Stock Number:
067795-MU
Citation ID:
RRID:MMRRC_067795-MU
Other Names:
R8310 (G1)
Major Collection:

Strain Information

Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Ddx1
Name: DEAD box helicase 1
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104721
VEGA: 12
HGNC: HGNC:2734
Homologene: 3627
Tars2
Name: threonyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: 2610024N01Rik, Tarsl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71807
Homologene: 23520
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Mon2
Name: MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms: SF21, 2610528O22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67074
VEGA: 10
Homologene: 44309
Dyrk1a
Name: dual-specificity tyrosine phosphorylation regulated kinase 1a
Synonyms: Mnbh, Dyrk, D16Ertd493e, 2310043O08Rik, D16Ertd272e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13548
HGNC: HGNC:3091
Homologene: 55576
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 136,087,337 bp
  • G to A, chromosome 1 at 153,754,988 bp
  • G to T, chromosome 2 at 37,429,884 bp
  • C to A, chromosome 2 at 164,238,171 bp
  • A to T, chromosome 2 at 177,831,799 bp
  • G to C, chromosome 3 at 92,850,459 bp
  • T to A, chromosome 3 at 95,750,959 bp
  • C to T, chromosome 3 at 154,704,949 bp
  • T to C, chromosome 4 at 134,229,419 bp
  • A to T, chromosome 5 at 21,301,471 bp
  • T to A, chromosome 5 at 38,128,039 bp
  • A to T, chromosome 5 at 96,091,676 bp
  • A to T, chromosome 5 at 97,391,878 bp
  • ACATCAGGATCC to ACATCAGGATCCCCATCAGGATCC, chromosome 6 at 4,756,454 bp
  • T to C, chromosome 6 at 12,396,613 bp
  • A to G, chromosome 6 at 121,363,291 bp
  • A to G, chromosome 7 at 5,221,025 bp
  • A to T, chromosome 7 at 12,810,189 bp
  • T to C, chromosome 7 at 16,995,401 bp
  • T to C, chromosome 7 at 20,844,894 bp
  • A to T, chromosome 8 at 4,301,786 bp
  • A to T, chromosome 8 at 69,613,795 bp
  • A to T, chromosome 8 at 70,852,805 bp
  • T to A, chromosome 8 at 71,397,985 bp
  • G to A, chromosome 8 at 117,742,416 bp
  • A to G, chromosome 9 at 100,552,788 bp
  • A to G, chromosome 10 at 5,347,829 bp
  • A to T, chromosome 10 at 18,783,788 bp
  • A to T, chromosome 10 at 64,089,708 bp
  • A to T, chromosome 10 at 107,777,600 bp
  • G to T, chromosome 10 at 123,002,783 bp
  • A to T, chromosome 11 at 9,378,269 bp
  • A to T, chromosome 11 at 55,179,332 bp
  • A to G, chromosome 11 at 62,132,345 bp
  • A to T, chromosome 11 at 67,096,007 bp
  • A to G, chromosome 11 at 69,940,368 bp
  • A to T, chromosome 12 at 8,009,033 bp
  • A to C, chromosome 12 at 13,224,279 bp
  • A to T, chromosome 12 at 110,545,825 bp
  • T to G, chromosome 13 at 30,381,762 bp
  • T to G, chromosome 13 at 48,514,251 bp
  • A to G, chromosome 14 at 52,463,823 bp
  • C to T, chromosome 14 at 63,943,826 bp
  • G to A, chromosome 15 at 9,103,332 bp
  • A to G, chromosome 16 at 17,354,048 bp
  • A to G, chromosome 16 at 94,691,791 bp
  • T to C, chromosome 17 at 37,499,257 bp
  • C to G, chromosome 17 at 71,255,146 bp
  • A to G, chromosome 17 at 84,773,096 bp
  • T to C, chromosome 18 at 12,193,398 bp
  • A to T, chromosome 18 at 24,271,629 bp
  • A to T, chromosome 18 at 35,979,713 bp
  • C to T, chromosome 18 at 63,735,685 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067795-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.