Strain Name:
C57BL/6J-MtgxR8297Btlr/Mmmh
Stock Number:
067853-MU
Citation ID:
RRID:MMRRC_067853-MU
Other Names:
R8297 (G1)
Major Collection:

Strain Information

Vangl2
Name: VANGL planar cell polarity 2
Synonyms: Lpp1, C530001F03Rik, skam17Jus, Ltap, strabismus, loop-tail, ska17, Lootl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93840
Homologene: 62161
Epha4
Name: Eph receptor A4
Synonyms: Sek, Sek1, Tyro1, Hek8, Cek8, 2900005C20Rik, rb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Ifi203
Name: interferon activated gene 203
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15950
HGNC: HGNC:5395
Homologene: 115929
Tnpo3
Name: transportin 3
Synonyms: 5730544L10Rik, C430013M08Rik, D6Ertd313e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320938
Homologene: 40848
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Cops2
Name: COP9 signalosome subunit 2
Synonyms: Sgn2, Trip15, alien-like, alien homologue, Csn2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12848
Homologene: 3124
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Xrcc5
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku80, Ku86
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22596
VEGA: 1
Homologene: 40681
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50883
Homologene: 38289
Ptpn6
Name: protein tyrosine phosphatase, non-receptor type 6
Synonyms: SHP-1, Ptp1C, hcp, Hcph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15170
HGNC: HGNC:9658
Homologene: 56589
Ets2
Name: E26 avian leukemia oncogene 2, 3' domain
Synonyms: Ets-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23872
HGNC: HGNC:3489
Homologene: 3838
Dcp1a
Name: decapping mRNA 1A
Synonyms: 1110066A22Rik, SMIF, 4930568L04Rik, D14Ertd817e, Mitc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75901
VEGA: 14
Homologene: 10178
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, 2410004E01Rik, Hip14l, skc4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243983
Homologene: 75106
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Arhgef2
Name: Rho/Rac guanine nucleotide exchange factor 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16800
HGNC: HGNC:682
Homologene: 3468
Gca
Name: grancalcin
Synonyms: 5133401E04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227960
Homologene: 22702
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Klhl8
Name: kelch-like 8
Synonyms: 2310001P09Rik, D5Ertd431e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246293
Homologene: 10819
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Vmn1r167
Name: vomeronasal 1 receptor 167
Synonyms: Gm6279
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 622032
Homologene: 128341
Itgal
Name: integrin alpha L
Synonyms: LFA-1, Cd11a, Ly-21, Ly-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Or2h15
Name: olfactory receptor family 2 subfamily H member 15
Synonyms: GA_x6K02T2PSCP-2579687-2578746, MOR256-49, Olfr132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257889
Homologene: 46430
Adamts19
Name: ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms: D230034E10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240322
VEGA: 18
Homologene: 15860
Nol4
Name: nucleolar protein 4
Synonyms: 4930568N03Rik, LOC383304, 1700013J13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319211
HGNC: HGNC:7870
Homologene: 36142
Ltb
Name: lymphotoxin B
Synonyms: lymphotoxin beta, Tnfc, p33, Tnfsf3, LTbeta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16994
HGNC: HGNC:6711
Homologene: 1752
Vsig10l
Name: V-set and immunoglobulin domain containing 10 like
Synonyms: 2210412E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75690
Homologene: 35386
Sytl2
Name: synaptotagmin-like 2
Synonyms: Slp2, Slp2-a, Slp2-d, Slp2-c, Slp2-b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83671
Homologene: 131343
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Atxn1
Name: ataxin 1
Synonyms: Atx1, Sca1, 2900016G23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20238
VEGA: 13
Homologene: 281
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Tgm6
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241636
Homologene: 27970
Fdps
Name: farnesyl diphosphate synthetase
Synonyms: Fdpsl1, 6030492I17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110196
HGNC: HGNC:3631
Homologene: 1519
Mvb12a
Name: multivesicular body subunit 12A
Synonyms: 1110012M11Rik, Fam125a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73711
Homologene: 12509
Krt77
Name: keratin 77
Synonyms: 4732484G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406220
Homologene: 45490
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Slc22a22
Name: solute carrier family 22 (organic cation transporter), member 22
Synonyms: OAT-PG, BC026439
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210463
Homologene: 18166
Klrb1
Name: killer cell lectin-like receptor subfamily B member 1
Synonyms: Ly-55, Ly55, Gm4696, 4930431A04Rik, Nkrp1g
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100043861
HGNC: HGNC:6373
Homologene: 135763
4933412E24Rik
Name: RIKEN cDNA 4933412E24 gene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71088
VEGA: 15
Homologene: 129990
Or2a54
Name: olfactory receptor family 2 subfamily A member 54
Synonyms: GA_x6K02T2P3E9-4442577-4441645, MOR261-3, Olfr441
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258649
Homologene: 88438
Kcnj13
Name: potassium inwardly-rectifying channel, subfamily J, member 13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040591
HGNC: HGNC:6259
Homologene: 55638
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207215
Homologene: 9459
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Mterf3
Name: mitochondrial transcription termination factor 3
Synonyms: 2410017I18Rik, Mterfd1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66410
Homologene: 9310
Prr5l
Name: proline rich 5 like
Synonyms: 4833411O04Rik, 2600010E01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72446
Homologene: 11753
1700020N01Rik
Name: RIKEN cDNA 1700020N01 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67692
Cd5
Name: CD5 antigen
Synonyms: Ly-A, Lyt-1, Ly-12, Ly-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12507
VEGA: 19
HGNC: HGNC:1685
Homologene: 7260
Ralyl
Name: RALY RNA binding protein-like
Synonyms: 0710005M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76897
Homologene: 18366
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12269
HGNC: HGNC:1325
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Or52e8b
Name: olfactory receptor family 52 subfamily E member 8B
Synonyms: GA_x6K02T2PBJ9-7653782-7652841, MOR32-9P, Olfr675
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258147
Homologene: 133595
Or10p22
Name: olfactory receptor family 10 subfamily P member 22
Synonyms: MOR269-3, GA_x6K02T2PULF-10675610-10676548, Olfr9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18373
Homologene: 85121
Clec4a1
Name: C-type lectin domain family 4, member a1
Synonyms: mDcir4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269799
Homologene: 72399
Cyb5d2
Name: cytochrome b5 domain containing 2
Synonyms: 9330151E16Rik, neuferricin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192986
Homologene: 14701
Ear14
Name: eosinophil-associated, ribonuclease A family, member 14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 503847
VEGA: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 72,325,085 bp
  • A to C, chromosome 1 at 77,506,910 bp
  • A to T, chromosome 1 at 87,386,467 bp
  • A to G, chromosome 1 at 130,636,745 bp
  • C to A, chromosome 1 at 172,009,946 bp
  • T to G, chromosome 1 at 173,937,930 bp
  • T to A, chromosome 2 at 52,308,763 bp
  • T to C, chromosome 2 at 62,686,356 bp
  • A to G, chromosome 2 at 76,786,141 bp
  • A to G, chromosome 2 at 101,741,285 bp
  • A to G, chromosome 2 at 110,661,271 bp
  • T to C, chromosome 2 at 125,859,108 bp
  • G to A, chromosome 2 at 130,137,438 bp
  • T to C, chromosome 3 at 14,039,776 bp
  • A to T, chromosome 3 at 88,639,432 bp
  • A to T, chromosome 3 at 89,093,741 bp
  • A to G, chromosome 3 at 96,654,800 bp
  • G to A, chromosome 4 at 108,479,708 bp
  • T to A, chromosome 4 at 143,949,120 bp
  • T to C, chromosome 5 at 103,863,088 bp
  • T to G, chromosome 5 at 110,848,436 bp
  • A to T, chromosome 6 at 29,582,303 bp
  • A to G, chromosome 6 at 43,116,506 bp
  • A to T, chromosome 6 at 120,381,555 bp
  • G to A, chromosome 6 at 122,922,001 bp
  • G to A, chromosome 6 at 124,728,651 bp
  • G to T, chromosome 6 at 128,712,259 bp
  • C to T, chromosome 7 at 23,504,790 bp
  • T to C, chromosome 7 at 43,464,107 bp
  • A to G, chromosome 7 at 48,815,509 bp
  • A to G, chromosome 7 at 90,385,075 bp
  • T to A, chromosome 7 at 101,504,673 bp
  • C to T, chromosome 7 at 105,024,678 bp
  • T to C, chromosome 7 at 127,330,466 bp
  • A to G, chromosome 8 at 71,545,244 bp
  • C to T, chromosome 9 at 21,166,108 bp
  • T to A, chromosome 9 at 110,635,341 bp
  • T to C, chromosome 10 at 21,621,679 bp
  • T to C, chromosome 10 at 128,990,839 bp
  • T to G, chromosome 11 at 29,705,536 bp
  • A to G, chromosome 11 at 72,789,103 bp
  • A to G, chromosome 11 at 86,712,631 bp
  • T to A, chromosome 12 at 71,951,915 bp
  • G to T, chromosome 13 at 45,567,029 bp
  • A to G, chromosome 13 at 66,907,158 bp
  • T to A, chromosome 13 at 92,439,589 bp
  • A to G, chromosome 14 at 30,522,926 bp
  • A to T, chromosome 14 at 51,204,107 bp
  • A to T, chromosome 15 at 57,259,110 bp
  • T to G, chromosome 15 at 60,015,675 bp
  • C to G, chromosome 15 at 82,029,262 bp
  • TGCCGCCGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCGCCGC, chromosome 15 at 101,859,972 bp
  • G to A, chromosome 16 at 36,969,308 bp
  • A to T, chromosome 16 at 74,015,926 bp
  • G to A, chromosome 16 at 95,706,454 bp
  • G to T, chromosome 17 at 35,194,679 bp
  • A to G, chromosome 17 at 38,130,593 bp
  • G to T, chromosome 17 at 50,047,380 bp
  • A to G, chromosome 17 at 74,625,104 bp
  • A to C, chromosome 18 at 20,332,033 bp
  • A to G, chromosome 18 at 23,040,012 bp
  • T to A, chromosome 18 at 58,837,848 bp
  • T to A, chromosome 19 at 10,720,245 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8297 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067853-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.