Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8902Btlr/Mmmh
Stock Number:
068759-MU
Citation ID:
RRID:MMRRC_068759-MU
Other Names:
R8902 (G1)
Major Collection:

Strain Information

Prkaca
Name: protein kinase, cAMP dependent, catalytic, alpha
Synonyms: Cs, C alpha, PKA, Pkaca
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18747
HGNC: HGNC:9380
Homologene: 121574
Glrb
Name: glycine receptor, beta subunit
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14658
HGNC: HGNC:4329
Homologene: 20224
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
App
Name: amyloid beta precursor protein
Synonyms: betaAPP, Abeta, protease nexin II, Adap, Cvap, appican, E030013M08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11820
VEGA: 16
HGNC: HGNC:620
Homologene: 56379
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 36,808,965 bp
  • A to T, chromosome 1 at 83,278,964 bp
  • G to T, chromosome 1 at 87,210,675 bp
  • T to C, chromosome 1 at 134,747,653 bp
  • C to T, chromosome 1 at 154,473,886 bp
  • T to A, chromosome 1 at 188,443,084 bp
  • A to T, chromosome 2 at 16,255,334 bp
  • C to A, chromosome 2 at 52,243,210 bp
  • C to T, chromosome 2 at 76,740,789 bp
  • A to G, chromosome 2 at 88,124,434 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • T to C, chromosome 2 at 157,199,500 bp
  • T to C, chromosome 3 at 59,336,212 bp
  • A to T, chromosome 3 at 80,861,978 bp
  • A to T, chromosome 3 at 92,135,671 bp
  • T to A, chromosome 3 at 139,298,409 bp
  • C to A, chromosome 4 at 49,319,836 bp
  • G to T, chromosome 4 at 88,522,310 bp
  • A to G, chromosome 4 at 120,096,740 bp
  • G to T, chromosome 4 at 155,905,914 bp
  • C to T, chromosome 5 at 25,517,910 bp
  • G to A, chromosome 5 at 43,615,862 bp
  • T to C, chromosome 5 at 87,460,411 bp
  • C to T, chromosome 5 at 124,835,641 bp
  • T to C, chromosome 5 at 134,249,866 bp
  • G to T, chromosome 6 at 49,088,431 bp
  • A to G, chromosome 6 at 137,512,177 bp
  • T to A, chromosome 7 at 16,177,962 bp
  • T to C, chromosome 7 at 30,013,882 bp
  • A to G, chromosome 7 at 67,693,013 bp
  • C to T, chromosome 7 at 98,092,613 bp
  • A to T, chromosome 7 at 140,110,586 bp
  • T to A, chromosome 7 at 141,647,524 bp
  • A to G, chromosome 7 at 142,229,893 bp
  • T to C, chromosome 8 at 83,977,085 bp
  • A to G, chromosome 8 at 117,377,186 bp
  • A to G, chromosome 9 at 5,299,333 bp
  • T to C, chromosome 9 at 7,639,287 bp
  • T to G, chromosome 9 at 54,892,502 bp
  • T to C, chromosome 9 at 65,651,069 bp
  • A to G, chromosome 9 at 73,749,548 bp
  • T to A, chromosome 9 at 114,496,552 bp
  • C to A, chromosome 10 at 62,598,707 bp
  • C to A, chromosome 10 at 86,713,001 bp
  • A to T, chromosome 11 at 49,318,379 bp
  • T to C, chromosome 11 at 55,310,070 bp
  • C to A, chromosome 11 at 59,135,936 bp
  • G to A, chromosome 11 at 76,212,022 bp
  • T to A, chromosome 11 at 96,817,794 bp
  • A to T, chromosome 11 at 118,275,014 bp
  • T to C, chromosome 12 at 75,453,796 bp
  • A to T, chromosome 12 at 103,898,858 bp
  • C to T, chromosome 13 at 95,682,203 bp
  • C to T, chromosome 14 at 21,669,561 bp
  • G to A, chromosome 14 at 52,490,553 bp
  • C to T, chromosome 15 at 81,006,595 bp
  • C to A, chromosome 15 at 82,070,011 bp
  • T to A, chromosome 16 at 19,286,633 bp
  • A to G, chromosome 16 at 85,079,879 bp
  • T to C, chromosome 17 at 3,477,196 bp
  • T to A, chromosome 17 at 12,410,903 bp
  • T to C, chromosome 17 at 17,892,928 bp
  • T to C, chromosome 17 at 22,339,780 bp
  • T to A, chromosome 17 at 37,851,210 bp
  • A to G, chromosome 19 at 43,901,786 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8902 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068759-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.