Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8902Btlr/Mmmh
Stock Number:
068759-MU
Citation ID:
RRID:MMRRC_068759-MU
Other Names:
R8902 (G1)
Major Collection:

Strain Information

Prkaca
Name: protein kinase, cAMP dependent, catalytic, alpha
Synonyms: Cs, C alpha, PKA, Pkaca
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18747
HGNC: HGNC:9380
Homologene: 121574
Glrb
Name: glycine receptor, beta subunit
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14658
HGNC: HGNC:4329
Homologene: 20224
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
App
Name: amyloid beta precursor protein
Synonyms: betaAPP, Abeta, protease nexin II, Adap, Cvap, appican, E030013M08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11820
VEGA: 16
HGNC: HGNC:620
Homologene: 56379
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243905
Homologene: 136307
Kat6b
Name: K(lysine) acetyltransferase 6B
Synonyms: qkf, querkopf, Morf, B130044K16Rik, monocytic leukemia, Myst4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54169
Homologene: 136480
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: protein phosphatase 2A subunit beta, 4633401M22Rik, B56beta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Mmp20
Name: matrix metallopeptidase 20 (enamelysin)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30800
VEGA: 9
HGNC: HGNC:7167
Homologene: 21001
Ccdc92
Name: coiled-coil domain containing 92
Synonyms: D5Bwg0834e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215707
Homologene: 11848
Igf2bp3
Name: insulin-like growth factor 2 mRNA binding protein 3
Synonyms: 2610101N11Rik, IMP3, Koc13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140488
Homologene: 4773
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Ttc23
Name: tetratricopeptide repeat domain 23
Synonyms: 1600012K10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67009
Homologene: 11289
Plppr1
Name: phospholipid phosphatase related 1
Synonyms: PRG-3, E130309F12Rik, Lppr1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 272031
Homologene: 9815
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20980
Homologene: 22516
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Ddx21
Name: DExD box helicase 21
Synonyms: RH II/Gu, D10Ertd645e, D10Wsu42e, RH-II/Gualpha, DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56200
VEGA: 10
HGNC: HGNC:2744
Homologene: 3473
Cmip
Name: c-Maf inducing protein
Synonyms: 5830471E12Rik, 4933407C03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74440
Homologene: 18869
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276919
Homologene: 69193
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Casp1
Name: caspase 1
Synonyms: ICE, Caspase-1, interleukin 1 beta-converting enzyme, Il1bc
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12362
VEGA: 9
HGNC: HGNC:1499
Homologene: 133272
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Stpg2
Name: sperm tail PG rich repeat containing 2
Synonyms: LOC381476, B930007M17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381476
Homologene: 52167
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Serpina1c
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1C
Synonyms: PI6, PI3, Spi1-3, Spi1-6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20702
HGNC: HGNC:8941
Homologene: 20103
Sgsm3
Name: small G protein signaling modulator 3
Synonyms: 1810012I01Rik, CIP85, Rutbc3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105835
Homologene: 9249
Zfp944
Name: zinc finger protein 944
Synonyms: 6330416L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319615
VEGA: 17
Homologene: 133237
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: Cav2.3, Cchra1, alpha1E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
Acap3
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Synonyms: Kiaa1716-hp, Centb5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140500
Homologene: 23708
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Ifnb1
Name: interferon beta 1, fibroblast
Synonyms: interferon beta 1, fibroblast, Ifb, IFNB, IFN-beta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15977
HGNC: HGNC:5434
Homologene: 1640
Usp36
Name: ubiquitin specific peptidase 36
Synonyms: 2700002L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72344
Homologene: 11828
Or14j5
Name: olfactory receptor family 14 subfamily J member 5
Synonyms: MOR218-1, GA_x6K02T2PSCP-2307164-2308123, Olfr126
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258892
Homologene: 134080
Or4e5
Name: olfactory receptor family 4 subfamily E member 5
Synonyms: GA_x6K02T2RJGY-491851-492792, MOR244-1, MOR28, Olfr1507
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57269
HGNC: HGNC:8296
Homologene: 10736
Or2y1b
Name: olfactory receptor family 2 subfamily Y member 1B
Synonyms: GA_x6K02T2QP88-6117098-6116163, MOR256-55, L45, Olfr10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18307
Homologene: 81347
Chrng
Name: cholinergic receptor, nicotinic, gamma polypeptide
Synonyms: Achr-3, Acrg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11449
HGNC: HGNC:1967
Homologene: 3810
Or5d38
Name: olfactory receptor family 5 subfamily D member 38
Synonyms: GA_x6K02T2Q125-49616865-49615915, MOR174-6, Olfr1166
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258644
Homologene: 138307
Ccr4
Name: C-C motif chemokine receptor 4
Synonyms: CC CKR-4, Cmkbr4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12773
VEGA: 9
HGNC: HGNC:1605
Homologene: 21135
C1qtnf7
Name: C1q and tumor necrosis factor related protein 7
Synonyms: 5530401N20Rik, 8430425G24Rik, CTRP7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109323
Homologene: 12900
Cct8l1
Name: chaperonin containing TCP1 subunit 8-like 1
Synonyms: LOC242891, Gm443
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242891
Homologene: 40943
Fpr2
Name: formyl peptide receptor 2
Synonyms: E330010I07Rik, Fpr-rs2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14289
HGNC: HGNC:3827
Homologene: 74395
Or2m12
Name: olfactory receptor family 2 subfamily M member 12
Synonyms: GA_x54KRFPKG5P-15738260-15737319, MOR279-2, Olfr164
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258443
Homologene: 51725
Krtap5-5
Name: keratin associated protein 5-5
Synonyms: A030001H12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114666
Echs1
Name: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 93747
HGNC: HGNC:3151
Homologene: 3018
Lelp1
Name: late cornified envelope-like proline-rich 1
Synonyms: 1700012F11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69332
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Ugt2a2
Name: UDP glucuronosyltransferase 2 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 552899
Homologene: 115736
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 36,808,965 bp
  • A to T, chromosome 1 at 83,278,964 bp
  • G to T, chromosome 1 at 87,210,675 bp
  • T to C, chromosome 1 at 134,747,653 bp
  • C to T, chromosome 1 at 154,473,886 bp
  • T to A, chromosome 1 at 188,443,084 bp
  • A to T, chromosome 2 at 16,255,334 bp
  • C to A, chromosome 2 at 52,243,210 bp
  • C to T, chromosome 2 at 76,740,789 bp
  • A to G, chromosome 2 at 88,124,434 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • T to C, chromosome 2 at 157,199,500 bp
  • T to C, chromosome 3 at 59,336,212 bp
  • A to T, chromosome 3 at 80,861,978 bp
  • A to T, chromosome 3 at 92,135,671 bp
  • T to A, chromosome 3 at 139,298,409 bp
  • C to A, chromosome 4 at 49,319,836 bp
  • G to T, chromosome 4 at 88,522,310 bp
  • A to G, chromosome 4 at 120,096,740 bp
  • G to T, chromosome 4 at 155,905,914 bp
  • C to T, chromosome 5 at 25,517,910 bp
  • G to A, chromosome 5 at 43,615,862 bp
  • T to C, chromosome 5 at 87,460,411 bp
  • C to T, chromosome 5 at 124,835,641 bp
  • T to C, chromosome 5 at 134,249,866 bp
  • G to T, chromosome 6 at 49,088,431 bp
  • A to G, chromosome 6 at 137,512,177 bp
  • T to A, chromosome 7 at 16,177,962 bp
  • T to C, chromosome 7 at 30,013,882 bp
  • A to G, chromosome 7 at 67,693,013 bp
  • C to T, chromosome 7 at 98,092,613 bp
  • A to T, chromosome 7 at 140,110,586 bp
  • T to A, chromosome 7 at 141,647,524 bp
  • A to G, chromosome 7 at 142,229,893 bp
  • T to C, chromosome 8 at 83,977,085 bp
  • A to G, chromosome 8 at 117,377,186 bp
  • A to G, chromosome 9 at 5,299,333 bp
  • T to C, chromosome 9 at 7,639,287 bp
  • T to G, chromosome 9 at 54,892,502 bp
  • T to C, chromosome 9 at 65,651,069 bp
  • A to G, chromosome 9 at 73,749,548 bp
  • T to A, chromosome 9 at 114,496,552 bp
  • C to A, chromosome 10 at 62,598,707 bp
  • C to A, chromosome 10 at 86,713,001 bp
  • A to T, chromosome 11 at 49,318,379 bp
  • T to C, chromosome 11 at 55,310,070 bp
  • C to A, chromosome 11 at 59,135,936 bp
  • G to A, chromosome 11 at 76,212,022 bp
  • T to A, chromosome 11 at 96,817,794 bp
  • A to T, chromosome 11 at 118,275,014 bp
  • T to C, chromosome 12 at 75,453,796 bp
  • A to T, chromosome 12 at 103,898,858 bp
  • C to T, chromosome 13 at 95,682,203 bp
  • C to T, chromosome 14 at 21,669,561 bp
  • G to A, chromosome 14 at 52,490,553 bp
  • C to T, chromosome 15 at 81,006,595 bp
  • C to A, chromosome 15 at 82,070,011 bp
  • T to A, chromosome 16 at 19,286,633 bp
  • A to G, chromosome 16 at 85,079,879 bp
  • T to C, chromosome 17 at 3,477,196 bp
  • T to A, chromosome 17 at 12,410,903 bp
  • T to C, chromosome 17 at 17,892,928 bp
  • T to C, chromosome 17 at 22,339,780 bp
  • T to A, chromosome 17 at 37,851,210 bp
  • A to G, chromosome 19 at 43,901,786 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8902 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068759-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.