Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9255Btlr/Mmmh
Stock Number:
068961-MU
Citation ID:
RRID:MMRRC_068961-MU
Other Names:
R9255 (G1)
Major Collection:

Strain Information

Pdpk1
Name: 3-phosphoinositide dependent protein kinase 1
Synonyms: Pkb kinase, Pdk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18607
Homologene: 37643
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Mfn1
Name: mitofusin 1
Synonyms: 6330416C07Rik, 2310002F04Rik, D3Ertd265e, HR2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67414
Homologene: 11481
Micu1
Name: mitochondrial calcium uptake 1
Synonyms: C730016L05Rik, Cbara1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216001
HGNC: HGNC:1530
Homologene: 4431
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,790,147 bp
  • G to T, chromosome 1 at 59,483,336 bp
  • A to G, chromosome 1 at 91,961,451 bp
  • A to G, chromosome 1 at 166,152,617 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • A to T, chromosome 1 at 173,929,221 bp
  • C to T, chromosome 2 at 32,420,379 bp
  • T to C, chromosome 2 at 76,778,277 bp
  • T to G, chromosome 2 at 93,209,855 bp
  • A to G, chromosome 2 at 120,013,075 bp
  • T to A, chromosome 2 at 163,495,692 bp
  • G to A, chromosome 3 at 32,442,832 bp
  • T to C, chromosome 3 at 32,544,138 bp
  • T to C, chromosome 3 at 94,485,287 bp
  • T to C, chromosome 3 at 94,998,908 bp
  • T to A, chromosome 3 at 104,652,832 bp
  • A to G, chromosome 3 at 106,822,421 bp
  • T to C, chromosome 3 at 108,469,548 bp
  • C to A, chromosome 4 at 33,036,759 bp
  • T to A, chromosome 4 at 65,644,848 bp
  • T to G, chromosome 4 at 85,100,866 bp
  • A to T, chromosome 4 at 107,306,905 bp
  • T to G, chromosome 4 at 146,195,103 bp
  • T to C, chromosome 4 at 155,905,688 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • G to C, chromosome 5 at 117,879,337 bp
  • T to A, chromosome 6 at 29,409,238 bp
  • T to A, chromosome 6 at 34,812,905 bp
  • T to C, chromosome 6 at 41,461,249 bp
  • A to G, chromosome 6 at 121,649,836 bp
  • T to G, chromosome 6 at 129,432,245 bp
  • A to G, chromosome 6 at 131,309,983 bp
  • A to G, chromosome 7 at 30,958,245 bp
  • A to G, chromosome 7 at 34,125,483 bp
  • A to T, chromosome 7 at 43,024,541 bp
  • A to T, chromosome 7 at 76,766,402 bp
  • T to C, chromosome 7 at 140,466,510 bp
  • A to T, chromosome 8 at 4,234,504 bp
  • C to T, chromosome 8 at 5,098,565 bp
  • G to A, chromosome 8 at 13,073,472 bp
  • T to A, chromosome 8 at 31,155,542 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • A to T, chromosome 8 at 105,376,639 bp
  • A to G, chromosome 8 at 107,052,751 bp
  • A to G, chromosome 8 at 110,535,340 bp
  • T to A, chromosome 8 at 117,663,260 bp
  • T to C, chromosome 9 at 39,319,191 bp
  • T to A, chromosome 9 at 53,373,309 bp
  • A to C, chromosome 9 at 99,497,388 bp
  • C to T, chromosome 9 at 108,294,509 bp
  • C to T, chromosome 10 at 7,853,258 bp
  • T to A, chromosome 10 at 59,768,229 bp
  • A to T, chromosome 10 at 61,341,210 bp
  • A to C, chromosome 10 at 79,267,332 bp
  • A to C, chromosome 11 at 9,328,213 bp
  • T to A, chromosome 11 at 43,216,321 bp
  • C to T, chromosome 11 at 69,331,511 bp
  • C to A, chromosome 11 at 78,361,573 bp
  • C to T, chromosome 11 at 106,324,228 bp
  • A to T, chromosome 11 at 113,656,193 bp
  • A to C, chromosome 13 at 22,279,172 bp
  • A to G, chromosome 13 at 24,753,368 bp
  • A to T, chromosome 13 at 68,888,080 bp
  • T to A, chromosome 13 at 91,670,406 bp
  • A to G, chromosome 13 at 93,453,386 bp
  • A to G, chromosome 15 at 9,057,212 bp
  • G to A, chromosome 16 at 20,740,051 bp
  • A to G, chromosome 16 at 87,722,513 bp
  • T to C, chromosome 17 at 9,667,840 bp
  • A to G, chromosome 17 at 24,106,964 bp
  • A to G, chromosome 18 at 15,061,796 bp
  • T to A, chromosome 19 at 4,871,792 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9255 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068961-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.