Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9243Btlr/Mmmh
Stock Number:
069069-MU
Citation ID:
RRID:MMRRC_069069-MU
Other Names:
R9243 (G1)
Major Collection:

Strain Information

Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Myd88
Name: myeloid differentiation primary response gene 88
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17874
HGNC: HGNC:7562
Homologene: 1849
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Parp1
Name: poly (ADP-ribose) polymerase family, member 1
Synonyms: PARP, sPARP-1, Adprp, parp-1, 5830444G22Rik, Adprt1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11545
HGNC: HGNC:270
Homologene: 1222
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 65,168,497 bp (GRCm38)
  • A to T, chromosome 1 at 91,254,258 bp (GRCm38)
  • C to A, chromosome 1 at 91,972,789 bp (GRCm38)
  • T to C, chromosome 1 at 91,972,790 bp (GRCm38)
  • C to A, chromosome 1 at 158,936,193 bp (GRCm38)
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp (GRCm38)
  • T to G, chromosome 1 at 180,588,115 bp (GRCm38)
  • A to G, chromosome 2 at 19,383,262 bp (GRCm38)
  • A to G, chromosome 2 at 22,635,041 bp (GRCm38)
  • A to G, chromosome 2 at 86,753,938 bp (GRCm38)
  • G to A, chromosome 2 at 101,630,074 bp (GRCm38)
  • G to A, chromosome 2 at 152,004,592 bp (GRCm38)
  • A to G, chromosome 3 at 152,428,283 bp (GRCm38)
  • T to A, chromosome 4 at 11,771,333 bp (GRCm38)
  • C to T, chromosome 4 at 43,006,565 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • C to A, chromosome 4 at 55,009,595 bp (GRCm38)
  • A to G, chromosome 4 at 98,969,634 bp (GRCm38)
  • A to T, chromosome 4 at 118,541,892 bp (GRCm38)
  • C to T, chromosome 4 at 125,707,897 bp (GRCm38)
  • T to C, chromosome 5 at 34,898,932 bp (GRCm38)
  • T to A, chromosome 6 at 72,561,087 bp (GRCm38)
  • T to G, chromosome 6 at 129,591,832 bp (GRCm38)
  • A to G, chromosome 7 at 68,212,027 bp (GRCm38)
  • A to G, chromosome 7 at 103,560,575 bp (GRCm38)
  • A to T, chromosome 7 at 139,615,349 bp (GRCm38)
  • T to A, chromosome 8 at 128,707,106 bp (GRCm38)
  • C to T, chromosome 9 at 13,826,908 bp (GRCm38)
  • T to A, chromosome 9 at 15,332,309 bp (GRCm38)
  • A to T, chromosome 9 at 119,339,707 bp (GRCm38)
  • C to A, chromosome 10 at 80,639,814 bp (GRCm38)
  • A to G, chromosome 11 at 57,238,062 bp (GRCm38)
  • T to C, chromosome 11 at 59,132,566 bp (GRCm38)
  • A to G, chromosome 11 at 61,493,709 bp (GRCm38)
  • G to T, chromosome 11 at 75,650,611 bp (GRCm38)
  • T to A, chromosome 11 at 94,457,067 bp (GRCm38)
  • A to T, chromosome 11 at 99,985,818 bp (GRCm38)
  • A to G, chromosome 12 at 44,573,824 bp (GRCm38)
  • T to A, chromosome 12 at 53,141,252 bp (GRCm38)
  • T to C, chromosome 12 at 75,735,187 bp (GRCm38)
  • C to A, chromosome 13 at 23,880,449 bp (GRCm38)
  • T to C, chromosome 13 at 30,925,795 bp (GRCm38)
  • T to A, chromosome 13 at 77,125,456 bp (GRCm38)
  • T to A, chromosome 13 at 119,357,524 bp (GRCm38)
  • A to T, chromosome 14 at 26,927,753 bp (GRCm38)
  • A to G, chromosome 14 at 49,960,424 bp (GRCm38)
  • T to A, chromosome 16 at 32,497,174 bp (GRCm38)
  • A to T, chromosome 16 at 56,231,460 bp (GRCm38)
  • G to A, chromosome 17 at 13,234,750 bp (GRCm38)
  • G to A, chromosome 17 at 34,845,222 bp (GRCm38)
  • T to C, chromosome 17 at 37,610,517 bp (GRCm38)
  • A to G, chromosome 17 at 52,898,514 bp (GRCm38)
  • A to G, chromosome 18 at 37,486,936 bp (GRCm38)
  • C to G, chromosome 18 at 57,363,199 bp (GRCm38)
  • T to C, chromosome 18 at 82,643,925 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9243 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069069-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.