Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9416Btlr/Mmmh
Stock Number:
069220-MU
Citation ID:
RRID:MMRRC_069220-MU
Other Names:
R9416 (G1)
Major Collection:

Strain Information

Gpr6
Name: G protein-coupled receptor 6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140741
VEGA: 10
HGNC: HGNC:4515
Homologene: 38026
Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78244
Homologene: 6752
Ptma
Name: prothymosin alpha
Synonyms: Thym
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19231
HGNC: HGNC:9623
Homologene: 137217
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Prr11
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270906
Homologene: 10123
Dtna
Name: dystrobrevin alpha
Synonyms: alpha-dystrobrevin, A0, 87K protein, Dtn, adbn, a-DB-1, 2210407P21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13527
VEGA: 18
HGNC: HGNC:3057
Homologene: 20362
Cyp51
Name: cytochrome P450, family 51
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13121
HGNC: HGNC:2649
Homologene: 55488
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105377
Homologene: 13000
Thbs1
Name: thrombospondin 1
Synonyms: TSP1, TSP-1, Thbs-1, tbsp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77739
Homologene: 64642
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Lrrc8c
Name: leucine rich repeat containing 8 family, member C
Synonyms: E430036I04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100604
Homologene: 12997
Lct
Name: lactase
Synonyms: LOC226413, Lphl, LPH
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Fance
Name: Fanconi anemia, complementation group E
Synonyms: 2810451D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72775
HGNC: HGNC:3586
Homologene: 11066
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110893
Homologene: 62645
Stk33
Name: serine/threonine kinase 33
Synonyms: 4921505G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117229
Homologene: 75307
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Kcnh2
Name: potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms: merg1a, ether a go-go related, M-erg, LQT, Lqt2, ERG1, merg1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16511
HGNC: HGNC:6251
Homologene: 201
Or1e1c
Name: olfactory receptor family 1 subfamily E member 1C
Synonyms: GA_x6K02T2P1NL-3535075-3536028, MOR135-12, Olfr376
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258924
Homologene: 133579
Ppp1r18
Name: protein phosphatase 1, regulatory subunit 18
Synonyms: 2310014H01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76448
Homologene: 19512
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319734
Homologene: 26544
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Coro1b
Name: coronin, actin binding protein 1B
Synonyms: coronin 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23789
HGNC: HGNC:2253
Homologene: 40790
Slc2a4
Name: solute carrier family 2 (facilitated glucose transporter), member 4
Synonyms: Glut-4, Glut4, twgy
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20528
Homologene: 74381
Oosp1
Name: oocyte secreted protein 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170834
Homologene: 87189
Zfp438
Name: zinc finger protein 438
Synonyms: 9430091M14Rik, B830013J05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240186
VEGA: 18
Homologene: 18695
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Or2q1
Name: olfactory receptor family 2 subfamily Q member 1
Synonyms: GA_x6K02T2P3E9-4742413-4741481, MOR257-3, Olfr450
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258437
Homologene: 51720
Prps1l1
Name: phosphoribosyl pyrophosphate synthetase 1-like 1
Synonyms: 1700011K15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75456
HGNC: HGNC:9463
Homologene: 75282
Lax1
Name: lymphocyte transmembrane adaptor 1
Synonyms: E430019B13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240754
Homologene: 49504
Psme3
Name: proteaseome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki)
Synonyms: Ki, pa28g, PA28gamma, REGgamma
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19192
HGNC: HGNC:9570
Homologene: 2111
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Rab24
Name: RAB24, member RAS oncogene family
Synonyms: 6530406O07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19336
VEGA: 13
HGNC: HGNC:9765
Homologene: 40641
Semp2l2b
Name: SUMO/sentrin specific peptidase 2-like 2B
Synonyms: 4930444G20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114671
Homologene: 130042
Tex47
Name: testis expressed 47
Synonyms: 4921511H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70920
Homologene: 41723
Or8k17
Name: olfactory receptor family 8 subfamily K member 17
Synonyms: GA_x6K02T2Q125-47716657-47715716, MOR187-2, Olfr1048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259016
Reep6
Name: receptor accessory protein 6
Synonyms: Dp1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70335
Homologene: 133833
Mtarc1
Name: mitochondrial amidoxime reducing component 1
Synonyms: 1300013F15Rik, Mosc1, Marc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66112
Homologene: 129604
Zfp606
Name: zinc finger protein 606
Synonyms: 2410022M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67370
Homologene: 23514
Shroom4
Name: shroom family member 4
Synonyms: D430043L16Rik, Shrm4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 208431
Homologene: 26615
Nim1k
Name: NIM1 serine/threonine protein kinase
Synonyms: E130304F04Rik, Nim1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 245269
VEGA: 13
Homologene: 25286
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 36,164,522 bp (GRCm38)
  • A to G, chromosome 1 at 51,863,418 bp (GRCm38)
  • T to C, chromosome 1 at 54,278,831 bp (GRCm38)
  • A to G, chromosome 1 at 86,527,972 bp (GRCm38)
  • T to C, chromosome 1 at 128,300,592 bp (GRCm38)
  • C to T, chromosome 1 at 133,077,449 bp (GRCm38)
  • T to A, chromosome 1 at 133,684,014 bp (GRCm38)
  • T to A, chromosome 1 at 136,094,951 bp (GRCm38)
  • T to C, chromosome 1 at 184,795,436 bp (GRCm38)
  • A to G, chromosome 2 at 20,743,973 bp (GRCm38)
  • A to G, chromosome 2 at 52,247,203 bp (GRCm38)
  • T to A, chromosome 2 at 86,236,400 bp (GRCm38)
  • A to G, chromosome 2 at 118,117,502 bp (GRCm38)
  • T to C, chromosome 2 at 131,083,470 bp (GRCm38)
  • G to T, chromosome 2 at 181,998,854 bp (GRCm38)
  • T to A, chromosome 3 at 88,896,231 bp (GRCm38)
  • T to C, chromosome 3 at 108,414,768 bp (GRCm38)
  • C to T, chromosome 4 at 86,424,240 bp (GRCm38)
  • A to G, chromosome 5 at 4,100,198 bp (GRCm38)
  • T to C, chromosome 5 at 7,305,194 bp (GRCm38)
  • A to T, chromosome 5 at 24,332,966 bp (GRCm38)
  • A to G, chromosome 5 at 105,608,297 bp (GRCm38)
  • G to T, chromosome 6 at 42,818,263 bp (GRCm38)
  • A to T, chromosome 6 at 119,297,518 bp (GRCm38)
  • A to G, chromosome 6 at 120,388,095 bp (GRCm38)
  • A to T, chromosome 6 at 120,758,577 bp (GRCm38)
  • T to A, chromosome 7 at 12,493,980 bp (GRCm38)
  • A to T, chromosome 7 at 104,859,324 bp (GRCm38)
  • T to A, chromosome 7 at 109,341,482 bp (GRCm38)
  • C to T, chromosome 10 at 22,067,853 bp (GRCm38)
  • C to A, chromosome 10 at 41,070,948 bp (GRCm38)
  • A to G, chromosome 10 at 80,330,257 bp (GRCm38)
  • T to A, chromosome 11 at 69,945,902 bp (GRCm38)
  • T to C, chromosome 11 at 73,374,964 bp (GRCm38)
  • A to T, chromosome 11 at 87,101,428 bp (GRCm38)
  • T to C, chromosome 11 at 101,320,733 bp (GRCm38)
  • T to A, chromosome 12 at 34,985,090 bp (GRCm38)
  • T to A, chromosome 12 at 81,315,064 bp (GRCm38)
  • A to G, chromosome 13 at 55,320,236 bp (GRCm38)
  • G to A, chromosome 13 at 77,046,537 bp (GRCm38)
  • T to A, chromosome 13 at 100,161,735 bp (GRCm38)
  • A to T, chromosome 13 at 119,727,826 bp (GRCm38)
  • C to T, chromosome 14 at 50,892,768 bp (GRCm38)
  • T to C, chromosome 15 at 10,461,962 bp (GRCm38)
  • A to G, chromosome 15 at 56,668,288 bp (GRCm38)
  • G to A, chromosome 17 at 28,318,353 bp (GRCm38)
  • CGAGGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGAGGA, chromosome 17 at 35,873,851 bp (GRCm38)
  • A to C, chromosome 17 at 71,394,796 bp (GRCm38)
  • A to T, chromosome 17 at 84,458,864 bp (GRCm38)
  • A to T, chromosome 18 at 5,214,054 bp (GRCm38)
  • T to C, chromosome 18 at 23,647,055 bp (GRCm38)
  • C to T, chromosome 19 at 4,151,474 bp (GRCm38)
  • T to G, chromosome 19 at 9,012,902 bp (GRCm38)
  • T to C, chromosome 19 at 11,687,405 bp (GRCm38)
  • GCAACAACAACAACAACAACAACAACA to GCAACAACAACAACAACAACAACA, chromosome X at 6,624,077 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9416 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069220-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.