Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9434Btlr/Mmmh
Stock Number:
069238-MU
Citation ID:
RRID:MMRRC_069238-MU
Other Names:
R9434 (G1)
Major Collection:

Strain Information

Crhr2
Name: corticotropin releasing hormone receptor 2
Synonyms: Crfr2, CRF-R2, CRFR2beta, CRFR2alpha, CRF 2 receptor, CRH-R2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12922
HGNC: HGNC:2358
Homologene: 55612
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
Lgr4
Name: leucine-rich repeat-containing G protein-coupled receptor 4
Synonyms: A930009A08Rik, Gpr48, A330106J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107515
Homologene: 10226
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 68,042,614 bp (GRCm38)
  • G to A, chromosome 1 at 87,480,593 bp (GRCm38)
  • A to T, chromosome 1 at 170,965,816 bp (GRCm38)
  • A to T, chromosome 2 at 82,986,358 bp (GRCm38)
  • A to G, chromosome 2 at 89,363,348 bp (GRCm38)
  • A to G, chromosome 2 at 110,006,562 bp (GRCm38)
  • C to T, chromosome 2 at 168,184,457 bp (GRCm38)
  • T to C, chromosome 3 at 94,765,530 bp (GRCm38)
  • T to C, chromosome 3 at 116,423,443 bp (GRCm38)
  • C to T, chromosome 4 at 104,990,337 bp (GRCm38)
  • T to G, chromosome 4 at 134,202,242 bp (GRCm38)
  • T to C, chromosome 5 at 84,331,368 bp (GRCm38)
  • T to C, chromosome 5 at 100,092,784 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • A to G, chromosome 6 at 11,933,493 bp (GRCm38)
  • A to T, chromosome 6 at 55,092,527 bp (GRCm38)
  • T to A, chromosome 6 at 58,876,861 bp (GRCm38)
  • T to C, chromosome 6 at 88,911,792 bp (GRCm38)
  • A to T, chromosome 6 at 108,153,135 bp (GRCm38)
  • A to G, chromosome 6 at 130,063,120 bp (GRCm38)
  • G to A, chromosome 7 at 44,312,918 bp (GRCm38)
  • A to G, chromosome 7 at 99,470,340 bp (GRCm38)
  • A to G, chromosome 8 at 40,680,245 bp (GRCm38)
  • A to G, chromosome 8 at 125,815,773 bp (GRCm38)
  • C to A, chromosome 9 at 83,868,090 bp (GRCm38)
  • G to T, chromosome 9 at 118,807,247 bp (GRCm38)
  • A to T, chromosome 9 at 119,076,163 bp (GRCm38)
  • T to C, chromosome 10 at 127,545,820 bp (GRCm38)
  • A to G, chromosome 10 at 130,385,876 bp (GRCm38)
  • A to T, chromosome 11 at 73,954,836 bp (GRCm38)
  • T to C, chromosome 11 at 105,009,037 bp (GRCm38)
  • C to T, chromosome 11 at 116,012,668 bp (GRCm38)
  • A to G, chromosome 12 at 4,315,755 bp (GRCm38)
  • T to A, chromosome 13 at 22,293,620 bp (GRCm38)
  • C to A, chromosome 13 at 32,100,386 bp (GRCm38)
  • T to C, chromosome 13 at 81,518,173 bp (GRCm38)
  • T to C, chromosome 14 at 30,006,097 bp (GRCm38)
  • A to G, chromosome 14 at 65,008,057 bp (GRCm38)
  • A to T, chromosome 14 at 78,510,389 bp (GRCm38)
  • C to T, chromosome 15 at 9,157,227 bp (GRCm38)
  • T to C, chromosome 15 at 65,967,377 bp (GRCm38)
  • A to G, chromosome 16 at 23,146,947 bp (GRCm38)
  • T to C, chromosome 16 at 29,586,056 bp (GRCm38)
  • T to A, chromosome 16 at 36,709,500 bp (GRCm38)
  • T to A, chromosome 16 at 87,362,533 bp (GRCm38)
  • C to G, chromosome 16 at 87,719,715 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • T to C, chromosome 17 at 34,582,699 bp (GRCm38)
  • T to C, chromosome 17 at 37,280,363 bp (GRCm38)
  • G to T, chromosome 18 at 49,877,721 bp (GRCm38)
  • A to C, chromosome 19 at 11,896,029 bp (GRCm38)
  • A to G, chromosome 19 at 38,914,017 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9434 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069238-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.