Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9434Btlr/Mmmh
Stock Number:
069238-MU
Citation ID:
RRID:MMRRC_069238-MU
Other Names:
R9434 (G1)
Major Collection:

Strain Information

Crhr2
Name: corticotropin releasing hormone receptor 2
Synonyms: Crfr2, CRF-R2, CRFR2beta, CRFR2alpha, CRF 2 receptor, CRH-R2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12922
HGNC: HGNC:2358
Homologene: 55612
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
Lgr4
Name: leucine-rich repeat-containing G protein-coupled receptor 4
Synonyms: A930009A08Rik, Gpr48, A330106J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107515
Homologene: 10226
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22137
Homologene: 2489
N6amt1
Name: N-6 adenine-specific DNA methyltransferase 1 (putative)
Synonyms: 5830445C04Rik, Pred28, Hemk2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67768
Homologene: 5637
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11538
Homologene: 7617
Sumf1
Name: sulfatase modifying factor 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58911
Homologene: 16268
Il17rb
Name: interleukin 17 receptor B
Synonyms: Evi27, IL-17ER, IL17RH1, IL-17Rh1, Il17br
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50905
Homologene: 10287
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Gmds
Name: GDP-mannose 4, 6-dehydratase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218138
HGNC: HGNC:4369
Homologene: 75968
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Ncoa1
Name: nuclear receptor coactivator 1
Synonyms: SRC-a/NCoA-1, SRC-1, SRC1, steroid receptor coactivator-1, KAT13A, bHLHe74
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17977
VEGA: 12
HGNC: HGNC:7668
Homologene: 7859
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, D9Ertd428e, 6720458D17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Cgn
Name: cingulin
Synonyms: 6330408J11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70737
Homologene: 41394
Fyb2
Name: FYN binding protein 2
Synonyms: 1700024P16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242594
Homologene: 52981
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Ngef
Name: neuronal guanine nucleotide exchange factor
Synonyms: ephexin, Tims2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53972
HGNC: HGNC:7807
Homologene: 75120
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Lmbrd2
Name: LMBR1 domain containing 2
Synonyms: 9930036E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320506
VEGA: 15
Homologene: 44696
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Notch4
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
Ildr1
Name: immunoglobulin-like domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106347
Homologene: 15892
Adam24
Name: ADAM metallopeptidase domain 24
Synonyms: Dtgn5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13526
HGNC: HGNC:203
Homologene: 137232
Adipoq
Name: adiponectin, C1Q and collagen domain containing
Synonyms: adiponectin, adipo, apM1, GBP28, Acrp30, Acdc, APN, Ad
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11450
Homologene: 3525
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72184
Homologene: 27849
Hhla1
Name: HERV-H LTR-associating 1
Synonyms: F930104E18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 654498
HGNC: HGNC:4904
Homologene: 129987
Tmem150c
Name: transmembrane protein 150C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231503
Homologene: 18818
Plcd1
Name: phospholipase C, delta 1
Synonyms: PLC-delta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18799
VEGA: 9
HGNC: HGNC:9060
Homologene: 21252
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Vmn1r196
Name: vomeronasal 1 receptor 196
Synonyms: V1rh19
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100312484
Homologene: 110880
Zpld2
Name: zona pellucida like domain containing 2
Synonyms: Gm7534
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665186
Homologene: 104039
Tpra1
Name: transmembrane protein, adipocyte asscociated 1
Synonyms: Tpra40, 40kDa, Gpr175
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 24100
Homologene: 40799
Or1o4
Name: olfactory receptor family 1 subfamily O member 4
Synonyms: MOR156-1, GA_x6K02T2PSCP-1720261-1719344, Olfr99
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258508
Homologene: 74030
Cdc14a
Name: CDC14 cell division cycle 14A
Synonyms: CDC14A2, CDC14a1, Cdc14, A830059A17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229776
HGNC: HGNC:1718
Homologene: 75343
Fcgr2b
Name: Fc receptor, IgG, low affinity IIb
Synonyms: CD32, FcgRII, Fc[g]RII, Fc gamma RIIB, FcgammaRIIB, Fcgr2, Fcr-2, Ly-m20, Ly-17, LyM-1, Fcr-3, Fcgr2a, F630109E10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14130
Homologene: 2974
Tbc1d12
Name: TBC1D12: TBC1 domain family, member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 209478
VEGA: 19
Homologene: 50835
Or4a15
Name: olfactory receptor family 4 subfamily A member 15
Synonyms: GA_x6K02T2Q125-50805620-50804676, MOR231-2, Olfr1234
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258975
Homologene: 128156
Klra4
Name: killer cell lectin-like receptor, subfamily A, member 4
Synonyms: Chok, Ly49d, ly49r129
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16635
Homologene: 110821
Or10v1
Name: olfactory receptor family 10 subfamily V member 1
Synonyms: GA_x6K02T2RE5P-2247227-2248156, MOR266-4, Olfr1420
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258405
Homologene: 17234
Galk1
Name: galactokinase 1
Synonyms: Glk1, Glk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14635
HGNC: HGNC:4118
Homologene: 125
Or1e1b
Name: olfactory receptor family 1 subfamily E member 1B
Synonyms: MTPCR35, MOR135-18, GA_x6K02T2P1NL-4111497-4112433, Or1e1b-ps1, Olfr22-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258209
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 68,042,614 bp (GRCm38)
  • G to A, chromosome 1 at 87,480,593 bp (GRCm38)
  • A to T, chromosome 1 at 170,965,816 bp (GRCm38)
  • A to T, chromosome 2 at 82,986,358 bp (GRCm38)
  • A to G, chromosome 2 at 89,363,348 bp (GRCm38)
  • A to G, chromosome 2 at 110,006,562 bp (GRCm38)
  • C to T, chromosome 2 at 168,184,457 bp (GRCm38)
  • T to C, chromosome 3 at 94,765,530 bp (GRCm38)
  • T to C, chromosome 3 at 116,423,443 bp (GRCm38)
  • C to T, chromosome 4 at 104,990,337 bp (GRCm38)
  • T to G, chromosome 4 at 134,202,242 bp (GRCm38)
  • T to C, chromosome 5 at 84,331,368 bp (GRCm38)
  • T to C, chromosome 5 at 100,092,784 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • A to G, chromosome 6 at 11,933,493 bp (GRCm38)
  • A to T, chromosome 6 at 55,092,527 bp (GRCm38)
  • T to A, chromosome 6 at 58,876,861 bp (GRCm38)
  • T to C, chromosome 6 at 88,911,792 bp (GRCm38)
  • A to T, chromosome 6 at 108,153,135 bp (GRCm38)
  • A to G, chromosome 6 at 130,063,120 bp (GRCm38)
  • G to A, chromosome 7 at 44,312,918 bp (GRCm38)
  • A to G, chromosome 7 at 99,470,340 bp (GRCm38)
  • A to G, chromosome 8 at 40,680,245 bp (GRCm38)
  • A to G, chromosome 8 at 125,815,773 bp (GRCm38)
  • C to A, chromosome 9 at 83,868,090 bp (GRCm38)
  • G to T, chromosome 9 at 118,807,247 bp (GRCm38)
  • A to T, chromosome 9 at 119,076,163 bp (GRCm38)
  • T to C, chromosome 10 at 127,545,820 bp (GRCm38)
  • A to G, chromosome 10 at 130,385,876 bp (GRCm38)
  • A to T, chromosome 11 at 73,954,836 bp (GRCm38)
  • T to C, chromosome 11 at 105,009,037 bp (GRCm38)
  • C to T, chromosome 11 at 116,012,668 bp (GRCm38)
  • A to G, chromosome 12 at 4,315,755 bp (GRCm38)
  • T to A, chromosome 13 at 22,293,620 bp (GRCm38)
  • C to A, chromosome 13 at 32,100,386 bp (GRCm38)
  • T to C, chromosome 13 at 81,518,173 bp (GRCm38)
  • T to C, chromosome 14 at 30,006,097 bp (GRCm38)
  • A to G, chromosome 14 at 65,008,057 bp (GRCm38)
  • A to T, chromosome 14 at 78,510,389 bp (GRCm38)
  • C to T, chromosome 15 at 9,157,227 bp (GRCm38)
  • T to C, chromosome 15 at 65,967,377 bp (GRCm38)
  • A to G, chromosome 16 at 23,146,947 bp (GRCm38)
  • T to C, chromosome 16 at 29,586,056 bp (GRCm38)
  • T to A, chromosome 16 at 36,709,500 bp (GRCm38)
  • T to A, chromosome 16 at 87,362,533 bp (GRCm38)
  • C to G, chromosome 16 at 87,719,715 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • T to C, chromosome 17 at 34,582,699 bp (GRCm38)
  • T to C, chromosome 17 at 37,280,363 bp (GRCm38)
  • G to T, chromosome 18 at 49,877,721 bp (GRCm38)
  • A to C, chromosome 19 at 11,896,029 bp (GRCm38)
  • A to G, chromosome 19 at 38,914,017 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9434 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069238-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.