Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9453Btlr/Mmmh
Stock Number:
069256-MU
Citation ID:
RRID:MMRRC_069256-MU
Other Names:
R9453 (G1)
Major Collection:

Strain Information

Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Sephs1
Name: selenophosphate synthetase 1
Synonyms: SPS1, 1110046B24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109079
Homologene: 56558
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Agps
Name: alkylglycerone phosphate synthase
Synonyms: ADAPS, 9930035G10Rik, bs2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228061
HGNC: HGNC:327
Homologene: 2716
Eefsec
Name: eukaryotic elongation factor, selenocysteine-tRNA-specific
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65967
Homologene: 11073
Hmmr
Name: hyaluronan mediated motility receptor (RHAMM)
Synonyms: CD168, Rhamm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15366
HGNC: HGNC:5012
Homologene: 8271
Rpap3
Name: RNA polymerase II associated protein 3
Synonyms: 2310042P20Rik, D15Ertd682e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71919
VEGA: 15
Homologene: 11613
Zmym2
Name: zinc finger, MYM-type 2
Synonyms: SCLL, RAMP, MYM, FIM, Zfp198
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76007
VEGA: 14
Homologene: 12631
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Polr1has
Name: RNA polymerase I subunit H, antisense
Synonyms: 1700022C21Rik, Znrd1as
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76416
Homologene: 130062
2810021J22Rik
Name: RIKEN cDNA 2810021J22 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69944
Homologene: 138400
Chpf
Name: chondroitin polymerizing factor
Synonyms: 1700028N03Rik, D1Bwg1363e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74241
Homologene: 11574
Cyp4x1
Name: cytochrome P450, family 4, subfamily x, polypeptide 1
Synonyms: Cyp4a28-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 81906
Homologene: 75853
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20779
Homologene: 21120
D16Ertd472e
Name: DNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms: 2310009O17Rik, E330003K22Rik, 1700010I10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67102
Homologene: 9696
Garnl3
Name: GTPase activating RANGAP domain-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99326
Homologene: 13003
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216805
Homologene: 14583
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
St6galnac2
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Synonyms: ST6GalNAc II, Siat7, Siat7b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20446
Homologene: 4714
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Wdr95
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381693
Homologene: 124480
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Vnn1
Name: vanin 1
Synonyms: pantetheinase, V-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22361
Homologene: 32130
Gm5114
Name: predicted gene 5114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330513
Homologene: 45597
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629499
Homologene: 51864
Ttc39d
Name: tetratricopeptide repeat domain 39D
Synonyms: 4930560E09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67737
Homologene: 65053
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Trim75
Name: tripartite motif-containing 75
Synonyms: LOC333307
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333307
Homologene: 53452
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Plcl2
Name: phospholipase C-like 2
Synonyms: Plce2, PRIP-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224860
VEGA: 17
HGNC: HGNC:9064
Homologene: 9052
Zfp521
Name: zinc finger protein 521
Synonyms: B930086A16Rik, Evi3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20684
Homologene: 86761
Pdzd7
Name: PDZ domain containing 7
Synonyms: Pdzk7, EG435601
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100503041
Homologene: 129509
Zfp563
Name: zinc finger protein 563
Synonyms: zinc finger protein, Zfp413
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240068
Homologene: 77346
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: LOC381203, mOAT6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381203
Homologene: 87203
Cdh15
Name: cadherin 15
Synonyms: Cdh14, Mcad, M cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Klra5
Name: killer cell lectin-like receptor, subfamily A, member 5
Synonyms: Ly49e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16636
Homologene: 110821
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226356
Homologene: 88578
Oas1f
Name: 2'-5' oligoadenylate synthetase 1F
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243262
HGNC: HGNC:8086
Homologene: 86720
Padi4
Name: peptidyl arginine deiminase, type IV
Synonyms: PAD type IV, Pdi4, Pad4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18602
Homologene: 7883
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Or56a3b
Name: olfactory receptor family 56 subfamily A member 3B
Synonyms: GA_x6K02T2PBJ9-7750163-7751110, MOR40-14, Olfr681
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404318
Homologene: 81538
Vezt
Name: vezatin, adherens junctions transmembrane protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215008
Homologene: 9739
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67505
Homologene: 137377
Mrps11
Name: mitochondrial ribosomal protein S11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67994
Homologene: 32554
Cdk5rap1
Name: CDK5 regulatory subunit associated protein 1
Synonyms: 2310066P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66971
Homologene: 9502
Tnfsf13
Name: tumor necrosis factor (ligand) superfamily, member 13
Synonyms: 2310026N09Rik, TRDL1, TALL2, APRIL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69583
Homologene: 56971
Samd13
Name: sterile alpha motif domain containing 13
Synonyms: LOC381481
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75015
H1f0
Name: H1.0 linker histone
Synonyms: H1fv, D130017D06Rik, H1-0
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14958
VEGA: 15
HGNC: HGNC:4714
Homologene: 136788
Vmn2r42
Name: vomeronasal 2, receptor 42
Synonyms: V2r4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22310
Homologene: 113703
Or6y1
Name: olfactory receptor family 6 subfamily Y member 1
Synonyms: GA_x6K02T2P20D-20731742-20730694, GA_x6K02SYWY4V-595-239, MOR103-13P, MOR103-17, EG546747, Olfr413-ps1, Olfr220
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 546747
Homologene: 67062
Wdr83os
Name: WD repeat domain 83 opposite strand
Synonyms: BC056474
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 414077
Homologene: 13954
Trbv29
Name: T cell receptor beta variable 29
Synonyms: Vbeta7, Gm16649, Tcrb-V7, Trbv28a, Trbv28
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124698
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 75,476,210 bp (GRCm38)
  • A to G, chromosome 1 at 85,701,458 bp (GRCm38)
  • C to T, chromosome 1 at 119,925,631 bp (GRCm38)
  • A to T, chromosome 1 at 174,448,667 bp (GRCm38)
  • A to T, chromosome 2 at 4,884,363 bp (GRCm38)
  • A to G, chromosome 2 at 33,003,869 bp (GRCm38)
  • T to C, chromosome 2 at 69,458,488 bp (GRCm38)
  • A to C, chromosome 2 at 75,832,241 bp (GRCm38)
  • A to T, chromosome 2 at 154,348,665 bp (GRCm38)
  • A to T, chromosome 2 at 157,230,028 bp (GRCm38)
  • A to T, chromosome 2 at 157,465,932 bp (GRCm38)
  • G to T, chromosome 3 at 63,364,885 bp (GRCm38)
  • A to T, chromosome 3 at 146,662,755 bp (GRCm38)
  • T to C, chromosome 4 at 115,133,872 bp (GRCm38)
  • A to G, chromosome 4 at 140,752,639 bp (GRCm38)
  • T to C, chromosome 5 at 120,855,529 bp (GRCm38)
  • T to C, chromosome 5 at 149,552,452 bp (GRCm38)
  • T to A, chromosome 6 at 41,271,753 bp (GRCm38)
  • T to C, chromosome 6 at 88,376,355 bp (GRCm38)
  • C to A, chromosome 6 at 129,906,723 bp (GRCm38)
  • T to C, chromosome 7 at 8,184,296 bp (GRCm38)
  • A to T, chromosome 7 at 19,561,871 bp (GRCm38)
  • T to A, chromosome 7 at 39,408,818 bp (GRCm38)
  • T to C, chromosome 7 at 78,792,642 bp (GRCm38)
  • G to A, chromosome 7 at 85,151,489 bp (GRCm38)
  • T to A, chromosome 7 at 105,121,610 bp (GRCm38)
  • T to A, chromosome 8 at 64,983,909 bp (GRCm38)
  • G to C, chromosome 8 at 85,082,009 bp (GRCm38)
  • T to A, chromosome 8 at 87,781,623 bp (GRCm38)
  • A to G, chromosome 8 at 122,859,290 bp (GRCm38)
  • T to C, chromosome 9 at 18,660,765 bp (GRCm38)
  • T to C, chromosome 10 at 20,278,235 bp (GRCm38)
  • G to A, chromosome 10 at 23,900,825 bp (GRCm38)
  • T to C, chromosome 10 at 81,189,991 bp (GRCm38)
  • A to T, chromosome 10 at 93,996,994 bp (GRCm38)
  • A to G, chromosome 11 at 40,721,828 bp (GRCm38)
  • G to A, chromosome 11 at 58,880,228 bp (GRCm38)
  • A to G, chromosome 11 at 59,803,783 bp (GRCm38)
  • A to T, chromosome 11 at 69,685,184 bp (GRCm38)
  • A to G, chromosome 11 at 71,182,087 bp (GRCm38)
  • A to G, chromosome 11 at 75,506,386 bp (GRCm38)
  • A to G, chromosome 11 at 110,247,264 bp (GRCm38)
  • A to T, chromosome 11 at 116,678,518 bp (GRCm38)
  • G to T, chromosome 11 at 119,275,132 bp (GRCm38)
  • A to C, chromosome 11 at 119,275,133 bp (GRCm38)
  • T to A, chromosome 12 at 5,031,578 bp (GRCm38)
  • T to A, chromosome 13 at 27,773,887 bp (GRCm38)
  • T to A, chromosome 14 at 56,943,313 bp (GRCm38)
  • C to T, chromosome 15 at 79,028,747 bp (GRCm38)
  • A to G, chromosome 15 at 97,681,760 bp (GRCm38)
  • T to C, chromosome 16 at 29,420,841 bp (GRCm38)
  • T to A, chromosome 16 at 78,545,164 bp (GRCm38)
  • T to A, chromosome 17 at 33,089,591 bp (GRCm38)
  • TCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCAC, chromosome 17 at 36,965,047 bp (GRCm38)
  • C to A, chromosome 17 at 50,608,363 bp (GRCm38)
  • C to T, chromosome 17 at 57,306,191 bp (GRCm38)
  • T to C, chromosome 17 at 80,217,325 bp (GRCm38)
  • G to A, chromosome 18 at 13,844,236 bp (GRCm38)
  • G to A, chromosome 18 at 56,740,042 bp (GRCm38)
  • A to T, chromosome 18 at 67,856,283 bp (GRCm38)
  • G to A, chromosome 19 at 5,708,343 bp (GRCm38)
  • T to G, chromosome 19 at 5,972,996 bp (GRCm38)
  • A to G, chromosome 19 at 45,027,617 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9453 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069256-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text