Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9551Btlr/Mmmh
Stock Number:
069347-MU
Citation ID:
RRID:MMRRC_069347-MU
Other Names:
R9551 (G1)
Major Collection:

Strain Information

Phb1
Name: prohibitin 1
Synonyms: Phb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18673
HGNC: HGNC:8912
Homologene: 1980
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Depdc7
Name: DEP domain containing 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211896
Homologene: 16386
Elp3
Name: elongator acetyltransferase complex subunit 3
Synonyms: 2610507P14Rik, KAT9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74195
VEGA: 14
Homologene: 7105
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Par-1, Emk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Zfp512
Name: zinc finger protein 512
Synonyms: 2500002M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269639
Homologene: 13026
Ssb
Name: small RNA binding exonuclease protection factor La
Synonyms: La protein, SS-B, autoantigen La, Sjogren syndrome antigen B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20823
Homologene: 2366
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Hnrnpk
Name: heterogeneous nuclear ribonucleoprotein K
Synonyms: hnRNPK, Hnrpk, KBBP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15387
HGNC: HGNC:5044
Homologene: 81909
Cep120
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225523
VEGA: 18
Homologene: 27415
Cnbp
Name: cellular nucleic acid binding protein
Synonyms: Znf9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12785
Homologene: 2567
Pbx1
Name: pre B cell leukemia homeobox 1
Synonyms: Pbx-1, D230003C07Rik, 2310056B04Rik, Pbx1a, Pbx1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18514
HGNC: HGNC:8632
Homologene: 20574
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Nmd3
Name: NMD3 ribosome export adaptor
Synonyms: C87860
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 97112
Homologene: 6127
Mgst3
Name: microsomal glutathione S-transferase 3
Synonyms: GST-III, 2010306B17Rik, 2010012L10Rik, 2700004G04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66447
HGNC: HGNC:7064
Homologene: 3327
Il15
Name: interleukin 15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16168
HGNC: HGNC:5977
Homologene: 487
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Fam124a
Name: family with sequence similarity 124, member A
Synonyms: EG629059
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 629059
Homologene: 86241
Scaf1
Name: SR-related CTD-associated factor 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233208
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69888
HGNC: HGNC:2622
Homologene: 133566
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ucp1
Name: uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms: Slc25a7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22227
Homologene: 22524
Zfp595
Name: zinc finger protein 595
Synonyms: A230042K10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218314
Homologene: 120258
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Tle5
Name: TLE family member 5, transcriptional modulator
Synonyms: Grg5, Grg, AES, Aes
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14797
VEGA: 10
HGNC: HGNC:307
Homologene: 879
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: semaphorin cytoplasmic domain-associated protein 3A, 1110020C07Rik, LNX3, Semcap3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Tmco4
Name: transmembrane and coiled-coil domains 4
Synonyms: 4632413C14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77056
Homologene: 57112
Mamdc4
Name: MAM domain containing 4
Synonyms: LOC381352
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381352
Homologene: 17102
Zfp175
Name: zinc finger protein 175
Synonyms: Zfp658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210104
Homologene: 134007
Or2y14
Name: olfactory receptor family 2 subfamily Y member 14
Synonyms: GA_x6K02T2QP88-5922712-5921756, MOR256-23, Olfr1384
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258464
Homologene: 74259
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Or6k4
Name: olfactory receptor family 6 subfamily K member 4
Synonyms: GA_x6K02T2P20D-21025190-21024243, MOR105-2, Olfr424
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258716
Homologene: 103798
Rpain
Name: RPA interacting protein
Synonyms: 2400006N03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69723
Homologene: 13006
Vmn1r86
Name: vomeronasal 1 receptor 86
Synonyms: Gm10301
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312473
Homologene: 74345
Vmn1r82
Name: vomeronasal 1 receptor 82
Synonyms: V1rg12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171268
Hs3st6
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328779
VEGA: 17
Homologene: 84633
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 3830409H07Rik, 4833409A17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Ccdc68
Name: coiled-coil domain containing 68
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381175
Homologene: 11880
Zpld2
Name: zona pellucida like domain containing 2
Synonyms: Gm7534
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665186
Homologene: 104039
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Wnt10b
Name: wingless-type MMTV integration site family, member 10B
Synonyms: Wnt12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22410
VEGA: 15
Homologene: 20721
Or11g1
Name: olfactory receptor family 11 subfamily G member 1
Synonyms: GA_x6K02T2PMLR-6110726-6111661, MOR106-3, Olfr738
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258662
Homologene: 74220
Mfsd9
Name: major facilitator superfamily domain containing 9
Synonyms: 4931419K03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211798
Homologene: 13100
Yipf4
Name: Yip1 domain family, member 4
Synonyms: 2310034L04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67864
VEGA: 17
Homologene: 32658
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Scgb2b19
Name: secretoglobin, family 2B, member 19
Synonyms: Gm5894, Abpbg19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545947
Homologene: 83171
Scgb1b12
Name: secretoglobin, family 1B, member 12
Synonyms: Gm9140, Abpa12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668381
Homologene: 114479
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 40,773,992 bp (GRCm38)
  • G to A, chromosome 1 at 68,740,483 bp (GRCm38)
  • T to C, chromosome 1 at 97,128,102 bp (GRCm38)
  • C to A, chromosome 1 at 136,527,481 bp (GRCm38)
  • T to C, chromosome 1 at 167,378,302 bp (GRCm38)
  • T to C, chromosome 1 at 168,431,341 bp (GRCm38)
  • A to T, chromosome 1 at 174,137,319 bp (GRCm38)
  • T to C, chromosome 2 at 25,570,023 bp (GRCm38)
  • T to C, chromosome 2 at 29,130,232 bp (GRCm38)
  • T to A, chromosome 2 at 35,715,318 bp (GRCm38)
  • T to A, chromosome 2 at 69,866,638 bp (GRCm38)
  • T to C, chromosome 2 at 91,170,089 bp (GRCm38)
  • C to T, chromosome 2 at 104,722,875 bp (GRCm38)
  • C to T, chromosome 2 at 129,115,764 bp (GRCm38)
  • C to A, chromosome 2 at 150,267,936 bp (GRCm38)
  • T to C, chromosome 3 at 69,739,996 bp (GRCm38)
  • T to C, chromosome 3 at 142,793,833 bp (GRCm38)
  • C to T, chromosome 4 at 113,940,855 bp (GRCm38)
  • G to A, chromosome 4 at 134,202,001 bp (GRCm38)
  • G to A, chromosome 4 at 139,052,584 bp (GRCm38)
  • G to A, chromosome 5 at 31,466,332 bp (GRCm38)
  • A to G, chromosome 6 at 87,845,126 bp (GRCm38)
  • T to C, chromosome 6 at 101,150,894 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • A to G, chromosome 7 at 12,305,673 bp (GRCm38)
  • A to T, chromosome 7 at 13,102,854 bp (GRCm38)
  • A to G, chromosome 7 at 27,459,361 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • C to A, chromosome 7 at 32,334,549 bp (GRCm38)
  • A to G, chromosome 7 at 33,279,773 bp (GRCm38)
  • G to T, chromosome 7 at 43,573,143 bp (GRCm38)
  • A to G, chromosome 7 at 45,008,927 bp (GRCm38)
  • A to G, chromosome 7 at 133,639,013 bp (GRCm38)
  • T to C, chromosome 7 at 138,394,269 bp (GRCm38)
  • T to G, chromosome 8 at 79,060,774 bp (GRCm38)
  • T to A, chromosome 8 at 82,334,548 bp (GRCm38)
  • T to C, chromosome 8 at 83,297,880 bp (GRCm38)
  • C to T, chromosome 9 at 103,222,084 bp (GRCm38)
  • T to C, chromosome 10 at 81,564,154 bp (GRCm38)
  • T to C, chromosome 10 at 100,536,867 bp (GRCm38)
  • C to T, chromosome 11 at 49,514,115 bp (GRCm38)
  • T to C, chromosome 11 at 70,974,990 bp (GRCm38)
  • G to A, chromosome 11 at 95,671,431 bp (GRCm38)
  • A to G, chromosome 13 at 58,396,244 bp (GRCm38)
  • A to T, chromosome 13 at 67,317,003 bp (GRCm38)
  • C to T, chromosome 14 at 50,414,168 bp (GRCm38)
  • A to G, chromosome 14 at 57,591,055 bp (GRCm38)
  • T to G, chromosome 14 at 62,606,539 bp (GRCm38)
  • T to C, chromosome 14 at 65,560,185 bp (GRCm38)
  • T to A, chromosome 15 at 48,791,960 bp (GRCm38)
  • T to C, chromosome 15 at 56,667,694 bp (GRCm38)
  • C to A, chromosome 15 at 98,772,832 bp (GRCm38)
  • T to A, chromosome 16 at 14,246,809 bp (GRCm38)
  • T to C, chromosome 16 at 17,307,710 bp (GRCm38)
  • T to C, chromosome 17 at 24,758,254 bp (GRCm38)
  • T to C, chromosome 17 at 74,499,029 bp (GRCm38)
  • T to A, chromosome 17 at 74,609,069 bp (GRCm38)
  • C to A, chromosome 18 at 53,685,961 bp (GRCm38)
  • T to C, chromosome 18 at 63,032,962 bp (GRCm38)
  • T to A, chromosome 18 at 69,956,042 bp (GRCm38)
  • G to T, chromosome 19 at 7,285,898 bp (GRCm38)
  • T to C, chromosome 19 at 39,183,802 bp (GRCm38)
  • G to A, chromosome 19 at 40,373,479 bp (GRCm38)
  • A to G, chromosome 19 at 42,731,317 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9551 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069347-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.