Strain Name:
C57BL/6J-MtgxR9788Btlr/Mmmh
Stock Number:
070033-MU
Citation ID:
RRID:MMRRC_070033-MU
Other Names:
R9788 (G1)
Major Collection:

Strain Information

Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Phf21a
Name: PHD finger protein 21A
Synonyms: 80kDa, Braf35/HDAC complex (Bhc), PFTF1, Bhc80, D030065N23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192285
Homologene: 9597
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Trip4
Name: thyroid hormone receptor interactor 4
Synonyms: ASC-1, 4930558E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56404
Homologene: 9426
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Gtf2b
Name: general transcription factor IIB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229906
HGNC: HGNC:4648
Homologene: 1158
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64706
Homologene: 11224
Or4m1
Name: olfactory receptor family 4 subfamily M member 1
Synonyms: GA_x6K02T2PMLR-6013665-6012724, MOR242-1, Olfr734
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258658
Homologene: 51759
Elapor1
Name: endosome-lysosome associated apoptosis and autophagy regulator 1
Synonyms: Inceptor, Iir, 5330417C22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229722
Homologene: 23249
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Synrg
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Ldah
Name: lipid droplet associated hydrolase
Synonyms: 1110057K04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68832
VEGA: 12
Homologene: 41453
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, Plekhm1l, 9430067K14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Rai1
Name: retinoic acid induced 1
Synonyms: Gt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19377
HGNC: HGNC:9834
Homologene: 7508
Nxph1
Name: neurexophilin 1
Synonyms: C130005L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18231
Homologene: 8284
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Muc6
Name: mucin 6, gastric
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353328
HGNC: HGNC:7517
Homologene: 18768
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Gabra2
Name: gamma-aminobutyric acid type A receptor subunit alpha 2
Synonyms: Gabra-2, C630048P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14395
HGNC: HGNC:4076
Homologene: 20217
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Sarm1
Name: sterile alpha and HEAT/Armadillo motif containing 1
Synonyms: MyD88-5, A830091I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237868
Homologene: 9015
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Slc22a26
Name: solute carrier family 22 (organic cation transporter), member 26
Synonyms: BC014805
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236149
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Jakmip2
Name: janus kinase and microtubule interacting protein 2
Synonyms: 6430702L21Rik, D930046L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76217
VEGA: 18
Homologene: 8866
Or10j7
Name: olfactory receptor family 10 subfamily J member 7
Synonyms: GA_x6K02T2R7CC-664297-665229, MOR267-5, Olfr1406
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258758
Homologene: 133644
Izumo3
Name: IZUMO family member 3
Synonyms: 1700011H22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69314
Homologene: 122080
Mogat1
Name: monoacylglycerol O-acyltransferase 1
Synonyms: 0610030A14Rik, mDC2, MGAT1, 1110064N14Rik, Dgat2l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68393
Homologene: 105237
Or11l3
Name: olfactory receptor family 11 subfamily L member 3
Synonyms: GA_x6K02T2NKPP-794386-795357, MOR107-1, Olfr323
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258373
Homologene: 64865
Rsad2
Name: radical S-adenosyl methionine domain containing 2
Synonyms: Vig1, cig5, 2510004L01Rik, viperin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58185
Homologene: 10969
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Or8g21
Name: olfactory receptor family 8 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-32691280-32690354, MOR171-11, Olfr935
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258741
VEGA: 9
Homologene: 133683
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Osbpl3
Name: oxysterol binding protein-like 3
Synonyms: OSBP3, ORP3, 1200014M06Rik, 6720421I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71720
Homologene: 49422
Gfra1
Name: glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms: GDNFR-alpha, GFR alpha-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14585
HGNC: HGNC:4243
Homologene: 3855
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Lrrcc1
Name: leucine rich repeat and coiled-coil domain containing 1
Synonyms: 4932441F23Rik, 1200008A14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71710
Homologene: 12559
Bmp8b
Name: bone morphogenetic protein 8b
Synonyms: Op3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12164
HGNC: HGNC:1075
Homologene: 130625
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
Ear2
Name: eosinophil-associated, ribonuclease A family, member 2
Synonyms: eosinophil-derived neurotoxin, liver, Rnase2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13587
Homologene: 40596
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: bCEA, Cea11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Or5p4
Name: olfactory receptor family 5 subfamily P member 4
Synonyms: GA_x6K02T2PBJ9-10409785-10410723, MOR204-2, MOR204-39, Olfr481
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258927
Homologene: 105166
Klra9
Name: killer cell lectin-like receptor subfamily A, member 9
Synonyms: Ly49I, LY49I1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16640
Homologene: 110821
Zfp82
Name: zinc finger protein 82
Synonyms: KRAB16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330502
Homologene: 51177
Nab1
Name: Ngfi-A binding protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17936
HGNC: HGNC:7626
Homologene: 4352
C2cd2
Name: C2 calcium-dependent domain containing 2
Synonyms: ORF25, 5830404H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207781
VEGA: 16
HGNC: HGNC:1266
Homologene: 18368
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Nr1h4
Name: nuclear receptor subfamily 1, group H, member 4
Synonyms: RIP14, FXR, HRR1, Rxrip14, Fxr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20186
HGNC: HGNC:7967
Homologene: 3760
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, Myk1, Htk, Tyro11, b2b2412Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Mipep
Name: mitochondrial intermediate peptidase
Synonyms: 5730405E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70478
VEGA: 14
HGNC: HGNC:7104
Homologene: 4337
Zfp786
Name: zinc finger protein 786
Synonyms: A730012O14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330301
Homologene: 51849
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: 2610507K20Rik, UT-B, 3021401A05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Or1e31
Name: olfactory receptor family 1 subfamily E member 31
Synonyms: GA_x6K02T2P1NL-3951666-3950698, MOR135-24, MOR135-30_i, Olfr391-ps1, Olfr391-ps, Olfr391
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258236
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 52,490,007 bp (GRCm38)
  • T to C, chromosome 1 at 64,922,263 bp (GRCm38)
  • A to G, chromosome 1 at 78,522,705 bp (GRCm38)
  • T to C, chromosome 1 at 140,108,761 bp (GRCm38)
  • T to C, chromosome 1 at 150,652,582 bp (GRCm38)
  • C to T, chromosome 1 at 173,183,891 bp (GRCm38)
  • T to C, chromosome 2 at 92,351,633 bp (GRCm38)
  • T to A, chromosome 3 at 14,537,226 bp (GRCm38)
  • T to C, chromosome 3 at 63,773,715 bp (GRCm38)
  • T to C, chromosome 3 at 64,134,521 bp (GRCm38)
  • G to A, chromosome 3 at 108,469,981 bp (GRCm38)
  • AATCATC to AATC, chromosome 3 at 142,771,417 bp (GRCm38)
  • A to G, chromosome 4 at 24,586,204 bp (GRCm38)
  • G to A, chromosome 4 at 85,049,856 bp (GRCm38)
  • A to G, chromosome 4 at 92,146,800 bp (GRCm38)
  • A to G, chromosome 4 at 123,105,576 bp (GRCm38)
  • T to C, chromosome 5 at 71,034,797 bp (GRCm38)
  • C to T, chromosome 5 at 134,504,762 bp (GRCm38)
  • A to G, chromosome 5 at 136,991,057 bp (GRCm38)
  • T to G, chromosome 5 at 137,365,481 bp (GRCm38)
  • A to G, chromosome 6 at 9,247,418 bp (GRCm38)
  • A to G, chromosome 6 at 47,820,882 bp (GRCm38)
  • A to G, chromosome 6 at 50,347,364 bp (GRCm38)
  • T to A, chromosome 6 at 130,182,422 bp (GRCm38)
  • T to C, chromosome 7 at 17,090,599 bp (GRCm38)
  • C to T, chromosome 7 at 30,056,538 bp (GRCm38)
  • T to C, chromosome 7 at 108,081,538 bp (GRCm38)
  • T to C, chromosome 7 at 141,645,833 bp (GRCm38)
  • T to C, chromosome 8 at 48,335,561 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • A to G, chromosome 8 at 88,319,105 bp (GRCm38)
  • A to G, chromosome 9 at 38,995,000 bp (GRCm38)
  • T to C, chromosome 9 at 65,833,420 bp (GRCm38)
  • A to C, chromosome 9 at 66,399,903 bp (GRCm38)
  • C to T, chromosome 9 at 106,223,807 bp (GRCm38)
  • C to T, chromosome 10 at 18,165,599 bp (GRCm38)
  • A to G, chromosome 10 at 88,817,309 bp (GRCm38)
  • A to G, chromosome 10 at 89,478,776 bp (GRCm38)
  • A to T, chromosome 10 at 107,565,890 bp (GRCm38)
  • T to A, chromosome 11 at 58,625,866 bp (GRCm38)
  • A to G, chromosome 11 at 59,078,852 bp (GRCm38)
  • A to G, chromosome 11 at 60,187,254 bp (GRCm38)
  • T to C, chromosome 11 at 73,798,942 bp (GRCm38)
  • G to A, chromosome 11 at 74,084,450 bp (GRCm38)
  • A to G, chromosome 11 at 78,488,037 bp (GRCm38)
  • A to T, chromosome 11 at 83,986,955 bp (GRCm38)
  • A to T, chromosome 11 at 110,301,427 bp (GRCm38)
  • T to A, chromosome 11 at 115,344,261 bp (GRCm38)
  • A to T, chromosome 12 at 8,283,946 bp (GRCm38)
  • G to A, chromosome 12 at 26,450,578 bp (GRCm38)
  • A to T, chromosome 13 at 62,371,910 bp (GRCm38)
  • A to G, chromosome 14 at 44,103,248 bp (GRCm38)
  • A to G, chromosome 14 at 50,320,724 bp (GRCm38)
  • A to G, chromosome 14 at 60,846,444 bp (GRCm38)
  • A to G, chromosome 15 at 83,651,700 bp (GRCm38)
  • TATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA to TATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA, chromosome 16 at 91,656,811 bp (GRCm38)
  • A to G, chromosome 16 at 97,922,273 bp (GRCm38)
  • T to A, chromosome 17 at 84,547,464 bp (GRCm38)
  • T to A, chromosome 18 at 43,571,862 bp (GRCm38)
  • C to A, chromosome 18 at 78,109,592 bp (GRCm38)
  • G to A, chromosome 19 at 7,786,433 bp (GRCm38)
  • A to G, chromosome 19 at 17,477,881 bp (GRCm38)
  • A to G, chromosome 19 at 58,453,220 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9788 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
070033-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.