Loading Mouse GIF
Loading...

Strain Name:
C57BL/6N-Polgem5Lutzy/Mmjax
Stock Number:
071656-JAX
Citation ID:
RRID:MMRRC_071656-JAX
Other Names:
C57BL/6N-Polg^em5Lutzy/Mmjax; Polg^R292C

Strain Information

Polg
Name: polymerase (DNA directed), gamma
Synonyms: Pol gamma, polymerase gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, Polga
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18975
HGNC: HGNC:9179
Homologene: 2016
Polgem5Lutzy
Name: polymerase (DNA directed), gamma; endonuclease-mediated mutation 5, Cathy Lutz
Synonyms: PolgR292C
Type: Allele
Species: Mus musculus (mouse)
Chromosome: Chr7
Alteration at locus: Endonuclease-mediated
Genetic Alterations
Guide RNA (CTCCCATCCACAGGCTGCGC) was selected to cleave DNA and a single stranded oligo donor with the silent F290F (TTC to TTT) variant and missense R292C (CGC to TGC; arginine to cysteine) variant in exon 4 of the Polg (polymerase (DNA directed), gamma) gene. The guides and donor were introduced to C57BL/6N-Atm1Brd-derived JM8A3 ES-cell line. Mouse Polg transcript Polg-201 (ENSMUST00000073889) was used as reference for the exon number and guide sequences.
ES Cell Line
JM8A3 derived from C57BL/6N
Phenotype
Homozygous mice are born below expected Mendelian rations (9.8% of the expected 25% in het x het crosses). Homozygotes are normal in appearance. Homozygous males and females are fertile, however, females may have low productivity while males show no decrease in productivity.
Strain Development
The PolgR292C allele was generated using CRISPR/cas9 endonuclease-mediated genome editing. Guide RNAs (CTCCCATCCACAGGCTGCGC and TTCCAGCGCAGCCTGTGGAT) were selected to cleave DNA and a single-stranded oligo donor with the silent F290F (TTC to TTT) variant and missense R292C (CGC to TGC; arginine to cysteine) variant in exon 4 of the Polg (polymerase (DNA directed), gamma) gene on chromosome 7. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6NJ mice for germline transmission. Progeny were screened by DNA sequencing to correctly identify targeted pups. The colony was backcrossed to C57BL/6NJ for at least two generations.
Suggested Control Mice
C57BL/6N
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Publication neither planned nor in preparation

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N = 2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Reduced Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071656-JAX-HET-F
071656-JAX-HET-M
071656-JAX-WT-F
071656-JAX-WT-M
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$229.00 / $229.00
Non-Profit / For-Profit
Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
071656-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.