Loading Mouse GIF
Loading...

Strain Name:
B6J;129/SvJ-Gata2em1(Ccnb1)Cfplu/Mmjax
Stock Number:
071768-JAX
Citation ID:
RRID:MMRRC_071768-JAX
Other Names:
MD-GATA2

Strain Information

QUALITY CONTROL OF B6J;129/SvJ-Gata2em1(Ccnb1)Cfplu/Mmjax  |  The Jackson Laboratory
Last Updated:
Strain Data and Information Information by Submitter Assessed by MMRRC1,2
Published Provided
Allele-specific genotype3n.d.
Genetic backgroundn.d.
Viability of genotypes available for distributionn.d.
Specific Pathogen- Status n.d.
Recoverability of cryopreserved sperm/embryos4 n.d.
Gene or allele sequence3 n.d.
Gene or allele expression3n.d.
Gene or allele function3n.d.
Observable and/or measurable phenotypesn.d.
Fertility of genotypes available for distribution n.d.
Fecundity/breeding performancen.d.

1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.

2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.

3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.

4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.

Gata2em1(Ccnb1)Cfplu
Name: GATA binding protein 2; endonuclease-mediated mutation 1, Carlos-Filipe Pereira
Synonyms: MD-Gata2
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: CRISPR
Gata2
Name: GATA binding protein 2
Synonyms: Gata-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14461
HGNC: HGNC:4171
Homologene: 32030
Ccnb1
Name: cyclin B1
Synonyms: Cycb-4, Ccnb1-rs13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268697
HGNC: HGNC:1579
Homologene: 68982
Genetic Alterations

MD-Gata2 mice have the mitotic degradation (MD) domain sequence of cyclin B1 (Ccnb1) inserted after the start codon in exon 2 of the Gata2 gene, resulting in degradation of GATA2 during the mitosis-to-G1 (M-G1) transition. These mice may be useful when studying hematopoiesis.

Note that a control strain has been made available, MDMUT-Gata2 (Stock No. 071769).

ES Cell Line
C57BL/6N-PRX-B6N #1 derived from C57BL/6N
Phenotype
GATA2 is a zinc-finger transcription factor involved in regulating hematopoiesis and Cyclin B1 is a kinase that is necessary for cell cycle M-phase transition. This MD-Gata2 knock-in (KI) model was generated to investigate the idea of mitotic bookmarking as GATA2 is suggested to be a mitotic bookmark for multiple hematopoietic-related genes. These MD-Gata2 KI mice have a CRISPR-generated insertion of the cyclin B1 (Ccnb1) mitotic degradation (MD) domain sequence after the start codon in exon 2 of the GATA binding protein 2 (Gata2) gene. This mutation results in degradation of Gata2 expression during the mitosis-to-G1 (M-G1) transition.

Homozygous MD-Gata2 KI mice are embryonic lethal at the onset of definitive hematopoiesis, which is embryonic age E10.5-E11.5. The donating investigator notes that these homozygous KI mice phenocopy a published null allele, with a few exceptions including differences in yolk sac development. Heterozygous MD-Gata2 KI mice are viable and fertile but do demonstrate reduced hematopoietic stem cell function. These mice may be useful for studying the role of GATA2 in hematopoiesis.

Note that a control strain has been made available, MDMUT-Gata2 (Stock No. 071769).
MeSH Terms
  • Animals
  • Mice
  • Chromatin
  • Chromosomes/metabolism
  • DNA
  • Hematopoiesis/genetics
  • Mitosis
  • GATA2 Transcription Factor/genetics
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
  • Hematology
Donor
Filipe Pereira, Ph.D., Lund University.
Primary Reference

Silvério-Alves R, Kurochkin I, Rydström A, Vazquez Echegaray C, Haider J, Nicholls M, Rode C, Thelaus L, Lindgren AY, Ferreira AG, Brandão R, Larsson J, de Bruijn MFTR, Martin-Gonzalez J, Pereira CF. GATA2 mitotic bookmarking is required for definitive haematopoiesis. Nat Commun. 2023 Aug 14;14(1):4645. doi: 10.1038/s41467-023-40391-x. (Medline PMID: 37580379)

Strain Development

The MD-Gata2 knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (GACACAGTAGTGGACCATGGAGG) was used to introduce the mitotic degradation (MD) domain sequence of cyclin B1 (Ccnb1) inserted after the start codon in exon 2 of the GATA binding protein 2 gene (Gata2) on chromosome 6 (ENSMUSG00000015053). The gRNA was cloned in plasmid pX458 (Addgene; Cat#48138) that co-expresses GFP and Cas9 together with the gRNA. The homologous repair template used was a dsDNA construct where the MD sequence is flanked by 800bp homology arms. GFP-positive cells were sorted by FACs 48h later and plated, 6 days later individual ESC colonies were picked, expanded and genotyped. Two independent MD-Gata2-positive (C57BL/6N x 129S) F1 embryonic stem cell clones where then microinjected into 8-cell C57BL/6NRj morulae to generate chimeras. Correctly targeted pups were identified by PCR and sequencing. The resulting MD-Gata2 KI mice were bred to C57BL/6NRj (Janvier Labs) mice for at least 1 generation by the donating laboratory. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Mixed color
Eye
Unspecified
MMRRC Breeding System
Random intra-strain mating
Generation
N/A
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: No No
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
7 to 9
Recommended wean age
Other
Average Pups Weaned
7 to 9

Order Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071768-JAX-HET-F
071768-JAX-HET-M
071768-JAX-WT-F
071768-JAX-WT-M
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$229.00 / $229.00
Non-Profit / For-Profit
Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.